Description :
From Genome Similarity Track
Location :
Scaffold_1492:247- 2424
Transcript NameFunction/comments
Phypl_g13546hypothetical protein PHYSODRAFT_341850
Phypl_g13547hypothetical protein

Sequence
2177 bases(100 bases per row)
GATcgcacgagctcaagcgctggaGTTAGTCCGAGAGGCGGTCGAAGCGAGAGCACGACAGCAGAGCGAGATCGCAACCAAACACGCGATCGAGGCCGGA
GGGCGAGTGTGGCTTTACCTGGATCGAGTGAAGCCGGGGTACGTGCGCAAGCTTGCACACATGTGGCATGGGCCGTTCCgtgtcgtcgagctggtggaca
cgTTCATCGCGCGACTTGAGATGAACGGTACGCCCTATCAGCTCTACCCGATCGTGCACatctccaagttgaagcccgTCTGGGAGTTCCCGGCACGCCC
GGCGATACCGCTGACGGTGCCGGCCAGTGAGCGTTTCGATTTCGATGAAGAGCTCTTGCCAGAGGACAGCTGGGAAGCGGAGGAGTTGGATGACGACACC
TTCGAGGTCGAAGAGATCCTGGACATGCGCGAGGGCCGAGCCACGCGATATAGCCGCACGCGGCGCGAGTTCGAAGTGAGGTGGAAGGGTTACCCCGACA
CGACGTGGGTCGATGAGCTGGATCTCAACTGTGGCGGAATCCTGTACGACTTCTTGAGGCAGCGCACGGGGCGCAACCAGTTCGGCGTGATGCAGTCGCG
CgagaacgcggcggcggagccCGACCAAGGTGGGTGAACGCGTGGTGGAAGTCGGCAGGAGGGCTGCCGACAGGAGGAatggtggagacgctcgttCTAG
GACTGGCCGGGGTGAGAACAGAAATGGATGAAAGAGGGAAGCCTGGATGACCGACCTGTGGGTCGAAGATGGGACGCTGAAGGGCCGTCCCATAAGAAAA
GCGGAACGATATAGAAGGAAAGAGAGCCTGCTGAGAAGCAGTTGCGATATATTGGAAGTAAGTGAACTATGACTACGACATGTATGCATCGACGGACATC
TacagctcctcgatgaacttgccgGCGAGGTGAGGGAGGGAGTAAGCAGGGTGTGCGCGCGGCACGGTGCACTGGTGATTGGCGTCCAGCGGGGTGTGAA
AGAAGCGTCGCCAAGGTTGTtgagcgtcgacgtcgtctAACGCCGCTTGCAGAGTCGCATGTTGGAACTCGGGTACCAACGACTGACGGGCGACCGGCGC
GGCGTGAAAAGCAAGAACCacgggtccagcagcaggtctATGTCCGCGTGGCCACGCCGAAATAACTCCACGATCAACGTCAACAGGCCGTGCAGATGCT
CGCCGGCGTGCGACCGACGCGAGTTGCGACGTTTTCGCCAGCGGTCCCAATAGGCGCCGCTTGGTACGACCAACTCGTGGGTCGTCTCCCAATAGGCCAG
CGCCCAGTTGTTGAGGTGCACACGGTGACGAGCCACGAAAGCTGCGAAAGCTGCGAAAGCCGCGTCGCCCGACGCGAAGacgagcgtctccatcggCAAC
TTCAGATAATCCCAAGGCTCCGTAGCGTAAAGCGCCTCCACGTTCACCTGCGTCACCAACGCTGTGTTCCAGGACACCGGCTCGGGGTCAGCGCGGGCGG
GAAATATCCAACGGCGTGGAGGCAGGAACGTGAGGCGAATGTATCGAGCTGAGCTCGACGCTAACCGCATGGAGCGGAGCGACTTGGGCCACGGAGCATA
ACGCCTTCGCGCTCACTCCGACCGATCTTGCACGGACAGGATCGTCGGAGCGAAGAACGGCAGGGGAGCTCGCGCAACGCGTTGAGGAGacgaagaacgc
gacgaCGAATCCGATGAAGACCCGGatgaggaagagctggatgaCGACAGAGACTCATCGCCATCGGAACCTCCGGAGCCACCGCCCGACCCACCTTGGC
CTGCCGAATCCGCGGAAGATGATggcgaagagcgcgaagcacgccgacgaaggcgtcgacgcTTTGTCCGACCTGAGAGACCCCCGGAGTCGCTATGCGA
AGACCCGGTCTGCGACCCCGCAGACTGAGatcgccgtcgacgaggtggagggATCAAAGGTGGCACGGAAGGACGAGCCGGAGACACTGCACGGAGCCTG
GACACATGACCGGGCACCACGCGCGGTGAGGGAacggcgtcctccacgaggGGACACTGCCCGACGTCGCCAGGAAAAATCTGAGGTCTgtcgccagctt
gagcaggatCGAGAGCGGGAAGAGGAATcgcagcgaggacggcggGCCCGGCGGCTGCTTCCAAAGATCGGATAAGC