Description :
From Genome Similarity Track
Location :
Scaffold_44:247- 2013
Sequence
1766 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGATGCATCAACGCATATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGTGATCTTGGTCGGCCAC
CGCCAGGATCGGCGCCTCAGTCAAGCCCTGCTTGACTACATCGAAGGCCTGCTGACACTCAGCAGTCCAAATCCACTCGGCGTCCTCCTTCAGGAGCTGT
GACAGTGGGCGTATCATGCCCGCGTAGTCCTTCACGTATTTGCACAAGTACGTGGTCAAGCCAACTGCCGCAGTTCCTTGACGTTCGGCGGCGTCGGTCA
CTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCAGACACCGTTCTTCCCAACGTGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTC
TTCATGTTCGCATAGAGCTTGTGTTTGCGCATGAGCGCAAACAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCGGCAGCCCGGC
TGTGGACGAACACATCGTCGAAGTAGCTCGGTGCAAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCACAGGAGCGTTCTTCAG
ACCCTGCGGCATCACTAGCCACTCCCAGGGCATGCCGCTCGTCGTGCTCACGGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAATCCA
TCGCGCAGGTCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGT
TCAGCTTGTTGTACGCATGAACGATGCGCCAACCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCAGTGTGCGGGGATTCTGATTCCCGCACTTGTCC
AGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGTACGAGA
TCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGTTCCGCAGGGATCTCTTCGGGAAGCACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCG
TCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCAT
TCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCATGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAG
CGAAGTGCTTGCGTCGTAGGATTAGCGAGAGTCAGCTCCCTGTACCGAATCCGGAGGTACGCGTCAAGACGTTCAGCGTCTCGACGTCCGGCTTCTCAGC
CTCGGTCTGCCCAGCAGACATTTCTTGTAGCGTCTCGGCCCAGGCCGAGACTTGCGCAGCGGTCTTCGCATGCGCCGTCTTTTTGTTTTGCGGAGCCCGG
CTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTTTTCTTCTTCAGTACCGCCGGCGGGTACATCCCGCGGGCGAGCGACTTCAAGCCC
GGCTTGGTAGAACGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTTTTTCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCA
GCGTCGACTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATAGGCGGAGACCCTTTCG