Description :
From Genome Similarity Track
Location :
Scaffold_3884:247- 1866
Sequence
1619 bases(100 bases per row)
GAACTCGTGTTCCGCCGAAAAGCGTGACATCTCGCTGCTTCGGGCTGCGGGAAAGATGGGCCACTTCAAAGCGCGACTGTACCGCGGAAAGACTCCGCAG
ACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGTGAACCAGTAGGGGCGGGGCGCCCTACTG
GGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGTGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGG
CGGATTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACG
GTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCC
CCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCAT
GCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTT
CCCACCTCTGTTAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGTTTGGGAGTCGTCGACGTATTTGACGACTCCGAGG
ATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGAGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCAT
GAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTG
GGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGCGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGA
GTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGGCGTCGACAACGACGCCGCCGCCGCCTCGAGTCGGA
TCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACAACTTCGAT
GGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGAGGGTCGAGTCTT
TCCTGGACAACCTCAAGGCTGCAGAGATTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTAGCACGAGAA
CGTCCTGTAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGCTCTGAGATTCTCAAGAACCCCAAGTATCCGGTGTATCCTTTTGCTGACGCAGTATGC
TGACGTGGTGAACAAACAC