Description :
From Genome Similarity Track
Location :
Scaffold_3912:247- 1782
Sequence
1535 bases(100 bases per row)
GTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATAAGAGCGAGCGACATTCCGCTGACAGCGGTAAGTACTCCGAGCGGTAT
GCTCTGGGAATGGCTGGTGATGGCCCAGGGGCTGGGCGAACGCATCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTGTTAGGCCCCAACCGGGACGTA
CGCTCAAACGTACTTTAACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAG
TGCATGCGCACTAATAAGCTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTAC
GGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAA
GTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAG
GCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTTGTCTGTGACGCCTCCGATTTTGCAATCGGTT
GTGCTTTACTACAAGCAGACGCCGAAGGGCGTATACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAA
AGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTAGGCACT
GCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAACG
TAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTACCTGACTTGATACGCAAAGCGTATGCACA
AGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAGAGACTCTGACAAGGAATTGTCTGGGCGCTAACGCACGAGGCTGCATCGA
TACTCACACGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCT
ATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGT
CGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAGAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAATTTGCCTGTCCCCAAGGGATGCTGG
CAGTCCATGAGTATGGACTTTGTGTTTGCCCTTCC