Description :
From Genome Similarity Track
Location :
Scaffold_14:24698- 28569
Transcript NameFunction/comments
Phymu_g999serine hydrolase (FSH1)-like protein, putative
Phymu_g1000elicitin
Phymu_g1001hypothetical protein

Sequence
3871 bases(100 bases per row)
CCTCCTCCGTTTGAGTCCTCCAAGAAGATCCGTGTGCTATGTTTGCATGGGTTTCGCACCAACAAGGAGGTCATGTTGGACCAGACTCGAGGCCTTCGAG
CGGTGCTGGGGGATTCTGCTGAATTCGTGATACTGAACGGCACGTACGAAGCTCACGGGTCGAGTGACCCAATGATCGAGAACGCGTACAAGGCCCCGTT
CTACGAGTGGTTCGAGAATCAACTGGCTGATGGGTCTCCGCTATTGTATAACGACGCTGAATCATCCGCAAAGGCGCGTCTTCTAAGTGGCGCAGACAAA
GGAGAAGACCATGCGTGGAGTTTGTCCTACAAGGGTGTCGAGCAGTCGATGGTAAGGATCGACGAAGAACTTCGTCGCCATGGCCCGTTCGACGTTGTCA
TTGGGTTTTCCCAGGGTGCAGCGCTTCTGACAATTCTGACGATGTGGTATCTGCGTCACGGGGACGTGCGTTGGTGGAAGCTGGTGATCTGCGTTGGCGG
TGTGGATGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTGGATAAATCGGGCAACCGCATTTTCGTGCCTCTGCCTTCAATCCACCTAATTGGCAAGACG
GACCCGCTCTACCATGAGTCGCATCGCTTGGCATTGTCGTGGATGGACAAAGCGGAACCgaacgagttcaagaagcGGATCTACGTGCATGACGGCGGGC
ACAAATTCCCTTCCGTTTCGAAGAGCCGTGGATTCTACGCAGAGTTGGGCCAAATCATCAaacagcactgcaacaaagAGTTGGAAACATCGACAGCTAG
ATTGTAAGTGCGCACACAGCACATTTCCTAAAGTGTTTAAACAAAGAAATCTGTCAACGATTGCTAAAGTGGGTAAAATGTTTTCACTTTTCATCGAGGT
ACATTCACTTCGAGGCCAAACGAAAAGAAAACAGCACTTTTCAATTGTCCGAACGGAATATCGCAATTGACAATGCAAAACTAGAGAATTTCATGTCAAA
ACGGAACCTCATTCTTGATTTCATTTACTACGAGCTGTTTGTCAACGTCACTATCGCTGCCCATAGTTAGAAAGTAGCGAGCTTGGTCGCCTACGCCGAG
AGACCGAGAGCCGTGCAGTTCGGCAGGAAACtctccgccagctccagcacgttgaTCGACACGGTGCCAAAGTTGATGACGCAGTCCGATGGCTCGAGAG
CCAGGAGGTCGGCAACGAGCGAGTAGCAGTCCGAGGTCAAACACATGAGCAGGacctccgtctccgtcggATAGGCCGACGGCGGCACGAACGTGTAGCC
CGAGGCGGTCTGGCACGAGTCGAGGTACGGGTCAACGGCAagtgccagcagcttggcggTCTCCGAGGAGGGGCAAATGGTGGTCTCGTCATAAGCAGCA
GTCTGCGTGGCAAGgcaggcgacggcggcgacggcggcgtAGGTGAAGGTCTTCATGGTGTTGGAAGAGGAGGGAGGGAGGAAGCTGGTGTTGGAGCTTG
GAGGAAGATTGGATAATGAGCTTCAGATGGAGACTCGAGAGCGAATGCCTCGTGCTTCAGTCATCGAATCGGTGAGTACATGGACAGAAAATCTCTCGTC
AAACGGCGAATGTGACCGACGTTGTTCAACAAATTGCTGCGTCCCCAGCCAGCGGGAAGTTGGAAACCACAGTAGCAACGAAAAAAAAGGCTATGAAAGC
AAGCCTGTCTTGCACCCTGCAAGTTGCATGTGGCACTTTTTGCTGTGTTCACTTCTACCAGGATAGCGTTCATAGAGACTTGCTCTGGTGACCTGCATTC
CTGGTCCGCCCGAAGCGATCTTGACTGTTCTGGTGACTGCCGTGGAACGATGTAAAGCTCGGTGCGAGCTTGCTGACCATGCAGAAGCggacaacttcaa
cgagttTACCTGATCCGAGCTTACGTAAGGCTGAGACCGTACAACGGGCTCCGTTTCATGAACGGAGACTTCCAGGAGTATCGTTCCAGCGGAGACCACA
TACCATGCCAATAGAAATATcgtttttgctgctggaaccTACCTTGTTGCCTCCTAAAGTGACTGGAATTCATGAAAACTGCTCGATTCACTTTATCGTT
TACAAGACACAAGTTATCTTTTCCGACACTATCTCTGAGTCAGACTGGGCTTTCCACGATGGTTTATGTAATACAGTACTGGTACGGCAAACCAGTGGTT
TAACCACCCTGTGACCAGGATGTGTGCCCCGGAACATCAGTGAGTAAAGGTCCTCATCCTAGAGCGTCTAGGCTAGAAGCTTTCGCTTTCGTCGCACATG
CTGGTGTTCGACTGTCGTGCGGGAAAAGCTGTTCGTGTGTTGAAGTGCTACATGGCTGATAGGCAGTCGGCAGTCACTGCAAAGCTGGGTGTAGTGCAAT
TACTGAGTTCCGAATTGGCAACAGAATAGCGGTAGCGAAATTCCAAGatctcaagttgaagtttcATTGTGTGTCACTTAGGTAGATCCTTACTTCGTCC
TAATTCCGGTCTCAATTGCGATCTTCCTGCATTATGCTTGTCTATCTCGAGCTGATCGTGCTGCTTTATCTGGTCCTGCCACGCTTGTGTTCCCCGAATA
CCACTGGAACGCGTCAAGTTCAATGGCTGCAAGCGCCTTCTGGTGCCTCCACGTCGATGTTGGCTTGTGAGTTCACGCACTTGCACCCTCGACGATACGG
GGCCTATCACCTTCCCCtgttctcgtccagcatcacCATCGACGGCGTTTTGGACGAGAAAGCGTGGGCCGAAGTGCCATGGAGCGAGCCATTCCAAGAC
ATCCGCGGTCCGACGTTCTGGTCGCAGCCGTGGTTCAGCACAAAGTTCAAATTGCGGTACGACCAgcacttcctcttcatcggcGCTTATATCGAGGAAA
CCGAGGTGTGGGCCAACATCTCACAGCGCAACGAGGTCATTTACCATGACAACGACTTTGAAGTATTCGTAGATGCCGATGGGAGCACGCACAATTACAA
AGAGTTCGAACTGAACGCCCGCAACGCCACTTGGAACCTGTGGTTAAATCGGCCATACAGAAATGGTGGACACGAGAACAGCACTCGAGTGGACCCGCAA
CATGGCTTCGATATGCTGAACGGTGGCATGCGGTCGGCAGTTTTTGTCCGTGGACCGATCAATGATCCATGTACGTTGAAATAACTGTGAGCCACTTTGA
CTTTCTCAGCTAATTAATCGTTTCGATCCCGCTTTGCAGCCGAACGTCTACACTATTGGACTGCGGAAATTGCACTACCGTTGTCGGAGCTTGCATTGCA
TTCGACAGCACAAGTCCCACCGAAGCCCAAATCATATTGGAGGATCAATTTCTCACGTGTGGAGTGGCCAGTTCGTGTCTTAACGGATAAATCTACAGGC
AAGCAACATTACGAGAAGAAAGCTGGTTTAAAGGAGGAGAATTGGGTCTGGAGTGCTCAATATACGGTGGACATGCATCAGCCAGAGTGGTGGGGGTATC
TTCAGTTTCGACCGCAAGGGGAAACTCCGCCGGAGTTgagcgacgctgaagaagtggtCCCTTTTGATCCTGCTTGGGGGGTTCGATATGTGAGTTTTCA
ATTTTACTACGCGCAGCATGCATTTCACGATGCAACGGGGAAGTACACAGCAAGTTTGGAGCAATTGCTCCCTTACTTCACCAATCGCGAAGCCATTCAG
TGTACCAAGCTACTTGAAATGAGTGCCACCGACAAGACGTTTAGTGCTAAGATTGGACTCCGTACAATTCCTTTTGACAATAGCTCCGAGTTCATAGCAA
GCATCGAGGAAGACGGATACATTTCAGTGGAAAAGGTGCGCCATGCATCTGAGGCTACTGCAATCCAATGA