Description :
From Genome Similarity Track
Location :
Scaffold_9:24698- 26079
Sequence
1381 bases(100 bases per row)
CCCTGATGAACCTGTTCGTGCCAAGCTTCTGTATACTTGTTTCGCGCTCTCTGTAGCCACCGAGTTGTCCGCCGCATCGCTTGCCGCTTTATTGCAAGAG
GTATTGAATAGAGACCTATGCCTCCATCCTTGACCGGCAGGTAGAGCAGAGAAGGACTCACCTTGTGCCTCGTGCCATCTGTGCCAAGTGTCGATTTCCA
CAAAAATTGCTTTTGTAGGTTCACTAACTGGTCCACAACCTTCGCTGGAGGTTTGACGTATCCGGCCGTGAAAAGAATCGACGGCAGCAAGACCGAATTC
AGTATAAGCACTCTCCCCACCACACTGTTGGAGACTTTGGCCGCGATGATCAATCTAGTTCGGAGTTTTTGCAGGCGGTCCTCCCAATTAGCTTGCGTGA
TGTTCCCGGTTCCTATTTGGATACCAAGGTACCTCACCGTCTCTCCATGCCCCACGATTGGAATGCCGCATCTTTGTTTCTGGGTTACTGCTTTGTTGAG
ACATATATAACTGCTTTTCGTTGGTTGCACGTGCAGACCTGATTGCTGGCCGAACTCGGACAGCAGCTGCATCAGTCGAGGAAGCTGTTTCCCTTGTTTC
AAAAAGACAGCGGAGTCGTCAACGAAGGTCGAAATAAGATGGGGTTCTGCTCCGGATCTGGTCACGCGAATACCTTCCAGATGGGGGTCTTGTTGAACTG
CCAGTGCGAGAATCTCCGCGGCCACGATAAACAGCAGAGGGGCAAGGGGGCATCCTTGACGAATGCCCGACTTGACCTCCCATTCTGCCGACAGTTCTCC
GTTCACCAGGTACTGCGCTGTAGTATCCGAGTGCATACGACGTACTAAATCCACAAATTGTCGCCCGAAGCCGAATTTGCTTAGCACAAGGTACAGAAAG
TTTCGGTCCAATGTGTCGTAAGCCTTCATGAAGTCCAGCATCGCATTCCGGGAGCGTCATCCAACCCTTCAGCGCCGTTGTGGTACGCCTTATCCAATGC
GGCTTGCATGATGAGGATCGCGTTCTCCATCAGTCGATCCCGTACGAAACCTTGTTGTGCTTCCCCGATGATCCACAGAAGAATGTCTTGCAGCCTTGTT
GCCAGGACTTTTGCCAACAACTTGTAGGTAGTCGTAAGCAGAGTGATTGGTCTGTAATCGAGGGGATTTGGCGAATCTCCTTTCTTGCGCAACGGTATCA
CTATTCCTTGACCGAATGATCTTGGCATGGGTGCCCCGCGTTGGATGTTGTTGAATTCCCGCACCAAAACTTCGACCATCACGTTCTCGCAATCCTTGTA
GAAGTCATTGTTCAGACTGTCCACGCCTCCGGCCTTATTTCGATGTAAAGCCGCGATCGCTTCTCTTACTTCCTTTTCTGT