Description :
From Genome Similarity Track
Location :
Scaffold_1102:2468- 3674
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1102-fgenesh-gene-0.0Pyruvate dehydrogenase E1 component subunit alpha

Sequence
1206 bases(100 bases per row)
TCGACTCGACCATGCTCTTCcGCCAGACCGCCCGCGTCGCCTCGGCGCCGGCCGCGCGCCTCGCCAGCGCCCGCGCCTTCAGCTCGGCCAGTGGCGACGT
CACGTTCGAGTTCGCCAACTCGTTCAAGCTGCAtAACCTCGAGAGCGGTCCGGCCGAGAATGCCGTGAGCAACCGCGAGGAACTGCTCGGCTACTACCGC
CTCATGTACACGATGCGCCGCATGGAGATCACGGCCGACAACGAGTACAAGGCCCGTAACATCCGCGGTTTCTGCCACTTGTACGACGGTCAGGAGGCCG
TGGCCACGGGTGTCGAGGCCGCGCTCGACCGCAAGGACTCGTGGATTACCTCGTACCGTAACCACTGTACCATGCTCGCCCGTGGCGGTACCGTCAAGGA
AGTGCTTGGTGAGCTCTTTGGTACCCAGGCTGGTGCCATCAAGGGCAAGGGcGGCTCGATGCACTTCTACAAGAAGAAGGAGAACTTCTACGGTGGCCAG
GGTATCGTCGGTGCCCAGGTGCCAGTCGGTGTTGGTCTCGCCTTCGCCAGCAAGTACAACCACAACGGCGAGGGCCTCATGCCTTGCGCCATCACCATGT
ACGGTGACGGTGCCGCGAACCAGGGCCAGATCTGGGAGGCTGCCAACATGGCCGCTCTCTGGAAGCTCCCAGCGATTTTCTGCATTGAAAACAACCACTA
CGGTATGGGCACGTCGACGGCTCGCTCGTCGTCGAACCAGGAGTACTACACcATGGGTAACAAGATCCCAGGTATCTGGTGTGATGGTATGGACGTGCTC
GCTGTGCGTGAGTGCACCAAGTTCCTGAaGAAGTGGTGTGGTGAGGGCAACGGCCCAaTCTACGTCGAGATGAGCACCTACCGTTACCACGGTCACTCGA
TGTCGGACCCAGGTGTGACCTACCGTAACCGTGAGGAGATCTCGCAGATGCGTGCTTCGCGTGACCCAATCGAGAGCGTCAAGAAGCGCCTGCTCGAGGC
CAACCtCGCCaCGGCTGAGGAGATCAAGGAGATCGAGAAGGAGGTGCGTGCTGAGGTGGTTAAGGCCACCAAGGAGGCCAAGGCCAGCGGCCGCCCACTT
GAGCACATCGCCTTTGAGGACGTGTACACGGACGGCAAGGGTGGCAACGAGTTCCCGCCATTCATCCgaTTCCCAGACTACGCCAAGAGCCTGTACAACG
GCAAGC