Description :
From Genome Similarity Track
Location :
contig_53:246739- 249811
Transcript NameFunction/comments
g10354.t1hypothetical protein

Sequence
3072 bases(100 bases per row)
GAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTG
TGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCC
GCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACG
CCGATTCCGAGGAAAGACATGGTGCTCGACACATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGA
AGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAAT
CGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACG
TCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGAT
CCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAG
CTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCG
CGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTT
CCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAG
CTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGA
CCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTA
CAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGAGTCGACACGCAGTTGGC
GACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGT
ACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGA
TCGATACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTG
ATTCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGT
GGGTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCC
GTGGTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTT
CATCTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCT
CCGATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGCTCTTCAAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGA
CGGCCAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCTGAGAAGCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTC
GCTCTCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCATTTTACGTCAACTACGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCT
CGATTCCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGCACCTTTCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTC
CGCCTTGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGCCTCAACTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCA
TCTTGGACACGTCGGACGCTGATCAACCCACGTCAGCGTCCTCGTGCAATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCCGCGCCGCCTCCAG
CAAACTTTGACCCCATTCCGTCCCCACAACCGCGCGACACAGCGGCTGTCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGC
GATTGCAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCGACGCGGCCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACG
TCCGGCATTCAACCCATTTTGGTTACCAATTTGGGCGCGAACAAGCTCGCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCT
ACACGCTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTTTCTACGTCGGTCGGCTGCGGCGATACCATC