Description :
From Genome Similarity Track
Location :
scaffold_575:2467- 4134
Transcript NameFunction/comments
Pl_103702hypothetical protein PHYSODRAFT_483689

Sequence
1667 bases(100 bases per row)
CGGACCAAGCCCCTAGAGGTCATACGCGCCGAGGAGCGCGTGGAAGATATTCCCCGTACGCTGGGTATGTTCGATTTGATTTGCGTTGGAGTGGGAGGCA
CTATCGGAAGCGGCATCTTCTCCACAGCAGGGTCGATCATCTCGGAGACTGCTGGTCCCGCTGCCGTGGTGAGCTGGCTCATTGGTGGTGTCATTTGCTG
TCTCAATGCGCTGGCGTACATGGAGCTGACTACGCGAGTGCCGTCCTCAGGAAGTACGTATGCGTACGCCTACCACACGATTGGAGAGCTTCCTGCTGTC
GTAGCCGCTTGGCTACTGACCCTCGAGTACGCCGTGTCTGGTGCGGGTGTGGCGCGTAGCTGGGGAGACAAGGTAGAGGAATGGTTGCTGCTCGAGTACC
CTGACAAGAGCTTTCATTGGCTTAATCTGCAGTCTGCCAACCTCAGCGGCGGCCTCATCCAGTTCCTGAGTATGGTGGTGCTGCTGATGGGTGTCCGATT
TGGCAAAGCTTTCGTGAACACCGTGACGATGATTAAAATGGCCGTTGTAGCTTTCATCATCATTGCTGGCTTTGCTGCCATGAACCCCGACAATCTGTCG
CCATTTGTCCCTGAGCGCTCGGAGCTCGATGGTACAATGGCTTTCGGAACGCAAGGTATTATCACTGGTGCCTCACAGGCATTTTTTGGCTACGTTGGTT
TCGATGAAATTTGCTGTCTCGCCGGTGAGGCCAAGAACCCGAAGAAGATTATGCCTATTGCGGTCATGGTCGTTGTGGTTGGTACGATGATTCTCAGCGC
ACTGTGCTCTCTCGTTCTCGCAGGAATGGTAACTTACCTCGACGCTGGCAGTTTTGGTGACGGTTTTGAAGGCCACGGCTGGAAGTGGGCAGGAACAATT
GTACGTGCTGGTGAGGTGGTGACTATGCCTGTGGTGGCGCTTATTGGATTCTTGGCCCAGCCTCGATTGAATTACGCGCTTGCTTGCGATGGACTCTTAC
CGCGTATCTTCGCCGAGGTGGACTCCAAGGGTAACCTATTCAAGAACACGCTTATTACGGGTCTGTTCTTTACGGTGATTGCCGTCGTGGTGCCCTTCGA
TACACTGTGGGATATTGTAAACTTCGGTGTCATGATGTCGTTCATCATCGCGAATGTGTCCCTCACGCTGGCGCGGATGAAGCCGAAGTCGCCAAAGTTG
TCTCCGGTTTTGGTCGCCGCGCTCGTTGTCACGTCTGGATGCACGGCCTTTCTGTATCAGGAGGGATATGAAAACAGCTCGTCGACGGCTTGCCTGATTT
TGGCCATCATCTTCCTTGTCATCACCGTTGGAATCTCGGCAGTGCTGTTCGTGAAGTGTCCGCAGACAGCCAACTCGCCCGGTTTGTTCGCCGCTCCACT
GGTGCCGTTCATCCCAACGATTTGTATCCTCGCGGACTGGTACATGATTGCGCAGATCAGCCACTTAGCGCTAGGTCTTAGTGTCGCCTGGATGGCTTGC
GGCGCGCTATCATATTTTGTCTACGGTTATTTCCACGCAGAATCACGCAATGACTGGAGCCGAGTGATGAGCCAGAGCCTGCCTACCCACAATGACAGCC
TTTCGGCCCCTATGCTCTCGGCCAAGTTCTCGGTGCAGCAGGACCTCAAGTCCCCCGCCGTATAGGT