Description :
From Genome Similarity Track
Location :
Scaffold_360:24668- 25679
Transcript NameFunction/comments
g13699.t1hypothetical protein

Sequence
1011 bases(100 bases per row)
TTGATGCCGTCTCTGCATCGCAAGCCGCCACGACGGTAGCAGGCATGCCCAGGTTAACATCGCACACACCGGTGAAGTGCAGGGATTGAGATCCAGTGTG
ATTCGCAGGTACAGCACCAACATAGCTATCGGCTATCACAGAGAATCGAGTACCCTTGGAGCTGACATCCCATAGCTCAGCAATATGAGCACTGTGCAGC
TGTGCGCCGAGTGAGCCAGCACTTTCACCGCCGACGATGAGGTTGTCAACGTCCGGATAGTTCTCGAGCGCCCAGTTCAACGCTGCTTGGGTGTTGTTGT
ATCCGTTCAAGTGCATGGTATAGTTCAGTCCGAGACATTGCGGTTCTCCTAGTAGCCCCGCAACACTGCTGTCGTACGGCTCCAAGATCCTGTTCCCAGC
GTGGACATCTCCAGTGCAGTAAGGGATGAATACAATGTTCCAGTCCTTGAACATGTTGTCCGATATCGACCGATTCAGCACGCCTGCACTGCTTGACGTT
GCAGCGGTGGCGAGTGTCGCGCTAGCCCCCAGTGAGCATTGTAGACTAAAAGAGCACGTTTCCTCGTCAGTGCAGGCACCACCGCCCTGGAAGAAAATCA
TCAAGTTCGACTTGTCCAGATCCGCATTCGGGAACACTTGGAAGAAGTACGTCGAGTTCGTTGAGAACGCCGTCACCGAGTCCTGATAGTCGTCGAAAGC
ACAGCGTGTGTTGCCGCCCGGGTAGATGAGTACGCTGCCGTCATCGTCGGAGGGCGTGAGACTTCCGACGGCGCAGGTTTCAGAGCTACTGAGCGTGCAG
ATGGACTCAGCCGTGAAAGCCGGCACCGAAGCGAGGATCGCCGTTGCAGCGAGCAGGGTGGACGCGGTGTAAGTGAGATGCATGGATGCAGAAGCGTGAA
AGGTAGAGAGGGTTATGAAGCCGAGCTGGGGAAGCCGAAGTCAATTGAGAAATGAAGGATGACAAGTTGTCATTGACAACCAGCATATGCAGACCTCTTG
CCCACCGAAAG