Description :
From Genome Similarity Track
Location :
Scaffold_604:2466- 3995
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.6Sodium/hydrogen exchanger

Sequence
1529 bases(100 bases per row)
GACGACTTGAAGCGGCAGGAATGGACGGGTGGTGAGCTGCTCGTGTGCGCGCTGCTGGAGCTGCTTATCGTACGCATCGCGTATCAAATCGACCGAAGCA
AGACGGCGCCGTACCTGTCGACTGCTGCCTGGGCGATCGTACTCGGCATTGGGGTTCGNNNNNNNNNNTTTTGGCTTTGCTTGCCTTTAATGATTGAAAA
ACTTATGTTTGCGACTCGCTCATGTCTGTAGTTTGGCTTGATGCTGTCGCTGATATCAAAGGACGTACGTTTCTCTTCGTCATGTGCAAGTATCTCTTGT
CACTATGCTGACCAATATGATTCCATGTATCGTATATTTTGAAAAAGCGCGCGACAGACATCGGTTTGGATCCCCAGATCCTGTTCTTTGGACTTTTGCC
GCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAAGGCGGCTTCAGTACACAGCACCGCGGCTTTTTCGCCAACTTCTGGGACGTTTTCCTGCTC
GGTGTCGTTGGTACGGTTGGTGCGTCCGTCGTCACTGGCGCGCTGCTATACTGGCTCGGGCGCACATCGCTGCTCGCGATCGCGTTCACGCCCTCAGAAG
CCATGCTCTACGGCGCGCTAATCTCGGGAATTGACCCGATTGCGACTCAGCTCGTGCTTCGGAAAAGCCATGTGCCAACACTAATTCCGGAACTCGTCTT
TGGCGAGCGCTCGCTCAACAATGCCATCAGTAAGTTTGCATTGCTGTACAACTCTCGTCGAATGGTGAGGCTAATTTACGTTGGTGGATATGGCTGGTAA
ATAGCGGTTGCGTTGTTCAATCTGTGTGAAATGCGCGTGCAAAGCGGCAATTCTGAGGTGACATTTGCAAATGCGATGAATCTGTTTCTCGAACTGGTCG
GTGTCGGTGTCGGGTCGCTCGTGCTTGCTNNNNNNNNNNNNNNNNNNNNNNNNAATCGTCGGGTATTCGTCAGCGTATCTTCTCCGCGTAAGTCCATACT
TGCATGATTACATAATTGGAATATATATTGGTATAATGACAGGTTGTTGTTGCTTTCGGCCATCCATAGCGCTCGGACGAATTGCTCCGACAGCACCAAG
CGTACGAGATCTCAATTTTGCTGCTCTTTGCATACGCGAGTTACTTGGCGGGCGAGTTTTTCCACTTGAGCGGCCATTTGGCCGTGTTTTTCAGTGGCGC
GTTCATTCGCCACTACCACGTGTACAGCATTTCCCACGCGAGTGCGACGTCGTTCCGCCACTTACTGACCACGCTGTCGTTCCTCTCGGAGAATTTCATC
TTCATCTACCTGGGCGTCAGTATCTTTGCATGTATGTGCAAGGTCCTACCTCTGTGTGCACTACTGGTCTGAACGAGGTATGGAAACTAAATCATGTGGC
TACTCTTTGTAGACTCGGGCTCGTTTGAGTGGGAGTGGCGCTTCATCCTTGTGAGCTTTGTCGTGTGTCTCATTGCGCGCGCATTGATGACGTTTCCACT
GTGCTATGTTGCGAATCTGTGGCGATCGC