Description :
From Genome Similarity Track
Location :
Scaffold_4:246420- 251156
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002081Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
4736 bases(100 bases per row)
CGCTTCCTCGTTGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGCACTTCGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATG
TGCCACTCGGTTCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGA
TGTCATCGGGGAGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCTCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAA
TCTCGAAAGCAGGTCGCAACCCCTGTTTCGTCCTTCAAGACGGCGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGA
GATGGTTCGTTGAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGTGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAA
GAGCTGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGT
GAGTTCTGTGCACGTGCCGAGTTTTTTAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGTCTCGAGCATTGTGG
ACGAGCCGATTGACGTCCCAACGCAAGTTGTGACGTTCATGACGGGTCTGAACGACGGTCCAATCCGGAACCAATTGTTCCGTGAGTACCCAAAGACCCT
TGAAGAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTT
CATGATGGTCCAGAGCCAATGGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGGAAGTCGGGCC
ACTTCGCTCGAAACTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCG
TTCCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGAAACACAGGACTCTGGCC
CCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAAC
GCCTCTACGTGCTTTAGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAG
AAGATGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACG
AGTTCATTTTACTCGACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGAT
CTCCGTTGACAAGTCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTGT
GATATTGCGGTGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCT
CCTTTGCCATCGACGACAGAGTTGCGTGCGATGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCAA
GAAGAGTGTTCCGCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGTG
AACGTTCTGGTTTCGAACGAAGATGGTGACGTCGATGTAATCCATCACATGAAGATTGAAAATCCCCCAAGTTCAGTCGAAGAATTGATTTCCTTGCCAT
GGATGAGCAAGAAGACGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGTATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGT
ATCAGCAACGGAAGCCGAAGTGCTCGATGAAAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCGTGGGATGCTCTCAAGATGAACCCCGTGTATGCACTT
GCCAGGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAACTGCCATTTGATAGAGGCATTCGTCACGAGATTGACGTACTTCCTGGCACGAAGT
ACTGTATCACACGACAGTGGCCGTTGCCAAAGGAACAAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAA
GTCTCCACATGTAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCTGCTC
AGACTCCGGTTCCACGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAAT
GCGCAAAGACGATGTCCCACTAACTGCAGTGAGTACCCCTAGCGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCACCCGCGACC
TTCAATCGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTCGACGATATCTTCGTTCATAGTAAGCCACAAATGGGAGATC
TGATGTCGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCTTCGCTCCC
GAGATCCCTGTTCTCGGTTGTTTTGTGGGCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGAGCCAAAGAACGTCA
AACAGCTGAGACAATGGTTGGGTCTGGCCAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCCCTCACACAGCTCTTGAAGAAAGA
CGTTGAGTGGAAGTGGTCGAAAGACCATCAAACGGCGTTCGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTGGCTCTACCGAATCACGACAAG
CCGTTCCACGTCGTCTGTGATGCGAGCGATTATGCCATCGGTTGCGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGTTGTTTCGTATCAATCAC
GACAACTCCGACCCGCAGAACGGAACTATCCAGTTCACGACAAGGAGCTACTGGCAATGAAGTATGCTCTTGTCAAGTTCCGTGTCTATCTGCTTGGCGA
AGAGCGCTTTGCAATCTATACAGATCATGCGTCGCTGCGGACAGCAGTAAAGACTCCTCACTTGTCGCAAAGAATGGCGAGATGGTTCTCCTTCTTTGCG
GAGTACAACTTTGTTGTACACTACAAGCCAGGCAAAACGAACATCTTAGCCGACGCATTATCAAGACGTCCGGATTACGATCCAAAGTCCAAGAGTGAAA
ATATGGACGAAGAATGTCGACTTTGCGAAGATGTTCAAGCGGCCGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGATTGTCGAAGGGTACAAGTCTGA
CGAAACTTGTCAGGACTTGTTGAAGTACTTCAAAGACCCTTCTGACAAGGCACTGCAGAGCTTGCCTGCTAGAACAAGATCGCGCGTTCACCGCTTCCGA
GTACACAATGGGTTGTTGTATTATGCGGTGGAAGTTGAGGATACAGCACGAGTTGTTGTTCCCAACGATGAAGGTTTACGTCATCGACTCTTGTATGAGT
ACCATGACAGTCCTTCGGGTGGCCATCTCGGACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAA
GTATGTGAGAACTTGCGAGATCTGCCAGCGTGTGAAGCCATCTGGCTCCACGCAAGCCCCACTTCGTTCATTGGCTGTCCCATCGGACAGTTGGAAGTCT
GTGAGTATGGATTTCATATTCGGACTTCCTCGTGACAAACACGGACGCAATGGCATCCTTGTGTTTGTGGACCGATTCAGTAAGATGGTCCATCTTGCAC
CGGTTTCGGACAGATCTCAGCCGAATGACGGCAAGTCTTTGTAGACGTTGTTTCCGTCTACATGGCCTACCAGTCGAGATCGTGTCTGACGTGACACTCG
TTTCACATCAAGTTTTGGCGTGCACTGTTCAGACTTCTGGACACCAAGTTGTCCATGTCAACAGCAGCACACCCGGAAACGGATGGTCAAACTGAACGAG
TGAATCGTGTCCTGGAAGATGTATTGCGCAGCTATGCAACATCTTTCGGAGAGTGGAGTGAGTTTCTCCCTCTCGCTGAGTTTGCGTTGAACAACTCCAC
GCATGTCTCGACAGGTCACTCTCCATTTTATGTGAA