Description :
From Genome Similarity Track
Location :
Scaffold_33:246414- 247669
Transcript NameFunction/comments
g5230.t1RAW39894.1 hypothetical protein PC110_g3867 [Phytophthora cactorum

Sequence
1255 bases(100 bases per row)
CTACAGCAAGTGCGACTTCATCAACGACTGGTACTTGCGGTACAGGTACACAGCTCCTGCAGCCAGACCAATGAACAGCAGAGCGAAGGGCGTCTTCCAG
CCGCCGCTCGCGATGTCCGGATTCTCCTCCAGCTGCTTGGTGATCTTCTCGTTCACCTCGTCGCCCAGCACCTTCTTGGTGTTCTCCAGCGACGAGTCGA
TGCCCTTGCGTACCTTTGCCTCGATCTCGCGCACGCGGCGCTCGTTCTCGCCCTCTTGCTTCTTGAGTTTCGCCACGGTATTCTCTGTCTTCTCCTTCAG
ATCGGAGAAGCGGTGTTCAGCGTCGATACGGAAGTTCGACAGCTCCTTCTGCAGCACGGCGATCAGACAGTCCGTGCCGCAGTTCGGCGAGTCCATCCAC
TTCTTGTAGTCCTTGGACACCGAGTTCATCACCATCTCTGAGTCCACGGCGCCCGTCGTAGCGTCCGTGAAGTCTGTGTACGCGTCGAAGCGGATGATGT
CGTGGTTGTCGGCCAGCGCACCCGTGGACGCCGTGATGCCGATCGTAGACTCGCGTAGCCAGTCCTCGCTGAACGGCAGCGTCATCTCGTGGCAGGCCAC
CCACAGACCAGAGGCGTGTTCATCCACCTCCACCACGAGGCGCGTCTTATCGATCTTGACCTTGATGCGCGAGATGCTGTGCACGGGGTCGAAGTTGGCG
CTCTGCTCATGGTAGCGCACGGCGGCGTTGCATCCCGCGCGCTTGTCGTGGTACATTTGGTCATACGTCTTGGTGCCGTCGTTCACGAACACGCTCACGT
CCTTGTGGCCACCCTTGTGCTCAGGGTTGTTGAATGTGTCGATAACTACGCCGATACCCTTGTACTTGTCCGTGAAACCGTGGTTCACGCCGGGCGTGAA
CACCTTCTGGCCGGTGATCCAGAAACCGATGCCGTCGCCGAACCAGCGCTTGCCCTGGCCGGACACGCGGAACGTCAGAATGGCCGACAGCTCGTCGCGT
CCCACAGGGCTCTTCTGCCACAGGTGGCCACGCTTGCTCTGGCGGTCGGTGGTGAGGCGGATGAAGTGCTTTTTCACGTCCGCGTTGCCGCCGTGTGACC
ACGTGGTGTTGACCATGCGACGGCCCTCGGTGTCCACGACCTCGAATGGCGGCTTGAACGACACGTCGTCCATCTTGGCGGCGGCAGCGGGGCAGGACAG
CAGCGCCATGCACGCGCATAGCAGCAGCAGCAGCAGGCCGCGGGTCTTCATGGCG