Description :
From Genome Similarity Track
Location :
Scaffold_14:24639- 27821
Sequence
3182 bases(100 bases per row)
TAATTTTCCGGTGGATTATCTTGGAGAATTGGAGAGAATCGCGACGAGGTTTGATATTTGGAGATTGACGCTGGGAAACGACCCTCCTGCTCGAGTGCCA
CCTATGCGAATACGACTGAAAGAGGATGCTAAACCTTACAAATGTAAGGCAAGGAAGTATCCGCCGGAGGTCAGAAAGTTTATGGAGGACTTTGACAACA
AATTGGAGGGACTTGGATGGATCTACGAGAGTCCTAATAGTAGATGGGCTTGTCCAGCTCTGCCAGTTCGAAAGCCTGGTACTAACGAGTTTCGACAGAC
AGCAGATTACAAACCAACAAATTTCCAGATTGATGGTATTGTAGGCGTCATGCCAAACCCGCAAGTTGACTTGGAATCGGTGCGAGGATGTCAGTTCTTT
GGGCTGTTTGATTTTATCAAAGGGTACTGGCAGATTGCTTTGGATGAAGCTTGCCAAGAAATACTCTCCTACATGACCCACCAAAAGATCTACACGCCAA
GACGCGTACCACAAGGGAGTTGCGATGCAGCTTTGTTTTTTCAAGCAACGATTGAGAAGTGCCTACAAGAACTGTTGTACAAGCACTTATTGGTGTGGAT
AGATGACCTGCTACTCTATGCAGTCGATGTTAAGACGTATCTCTCAAAGTTGGAAAGATTGTTCGAGCTACTTGATTACTTTGGCTTTAAACTGAGTGTG
TCGAAGTCGAGTCTGTACGAATCGGAGGTTAAGTGGTGTGGTAAGATCATTACCGGTGCTGGTGTGAGCCACGACCCGGAGCGTATTAAAGCGTTGAGTA
CCGTACCGTATCCTACCAATGCTGGTGAGTTACAGCAATTTCTCTGTGCGTCCAACTGGATGCGTGAGAGTGTTGTGGACTTCGCCAGAGCAGCTACACC
ACTACAGGAAAAGCTGGATCAAGTACTTTCTACTGCATCAAAGAAGACAAAACGTGTAGCGTCTGGAATTGGCATAGAGTTGTCAAACAGCGAACGAGAG
GCGTTTGATGGCTTAAAGGACAAGCTAGTAAATGCAGCAAGTCTGGCTTTCCCTGATCCAGAGGCAGTGATGTGCCTCATCACTGACGCATCCGATATTG
GCTTCGGCATCATTGTGAGTCAAGTGCGCAAGTGGCAGACTGGGAAACCTGTAGTAGAACAACAGCATGAGCTTTTGGTGTGCGTAAGCGGCACATTTAC
GGGTTCGCAACGCAACTGGAGTGTCATCGAGAAAGAAGCGTACCCAATCATTTGTGCATGTGATCGACTCAGCTATCTGCTTTTACGCCCGCAAGGCTTC
CGGCTATTTTGCGATCACCGCAATCTAATCTACGTCTTTGCGCCAGGAAAGGAAGTCAAGAAGCACATCAGGGGCAAACTGTTGCGTTGGGCAATGAAGT
TAACAGAATACCGTTACCACATCGAGCATATCGACGGAACCAACAATGTGTGGGCTGATATGGTGTCGAGGTGGGCTGGCGATCACGACAATGGTGTAGC
TCTGCGAGCTATGGTGTTACGGAAACGCAGGCGAGGAGAGGAAGAAAGGACTCCGGTAAGCCGGAATAAGCGTCGACGAGGGAAGGAAGATAGGATCCCG
ACGATGCAGGCCAAGCGTCGAGGAGGGGAGGTAGATAGGACCCTGACGACACGACCAGTGAGCACTACATCGACTATAGCAAGCAACAACGCAGCAAAGA
CTGCTAGTAGAGCGGTAATACGACCGTTTGACGACCCAAACTTCACGTGGCCAACACTTAACGAGATTATTGTGGCTCAAGAGCAGCACAGAAGTACTGT
ACCAGCGGATACTTTGACTCGGGGTAACTCGGGCAAGGGTTGGTACTGCAAAGGAAGACTGTGGATCCCAGAAGCAGCGGAGGTACTTCTCCAGCGCCTC
ATGATCGTAGCACATTGTGGTGCACAAGGTCATAGAGGACGAGCCACTATGATGGAGCAACTACAACGACAGTTTTTTGTGGATCATTTACGAGCAAAAG
TGGATAAATTTTTGACATCATGCCTGTTGTGTCAGCATGTAAAGGGCGGTAAAGTGGTGCAGCGACCTTGGGGTGAAACACTACGTTGTCACGAGCGAAA
TGGAGTTCTACACTAGGATTTTCTCACTGTAGGTGAATCATTTGGCAGTGACAAATATCTACTTGTACTGAAGGATGAGGCGACTCACTACTGTGACCTG
GTGCCGTGTGCGACCCCCAATAGTGCTGTAGCGGTGGCGGCCATCCTAGACTGGCACGGCCGGTACGGCATTCCACCAGTATGGGTGAGCGACCAAGGTA
GCCATTTCAAGAATGCAGTTGTAGCAGACGTATGCAAACGACTAAGATGCGAACAAAGTTTCACGGTGGCTTACAGCCCCTGGATCAATGGTAGCATCGA
ACGTGTGAACCGTGACGTGATCCAAGTGCTCAGAGTACTCTGTCTAGAGTATAAAAAGGACATTAAGGACTGGACATCTTTTGTACCGCTGCTAAAGGCA
AGTATAAATCATACACCACTGCCGTCACTTGGGAACAAGGCTCCTGTGGAGTTATTCTGTGCGCTGCCGCTACCGAGCCCACTCGAGTTTTGTGTAGACC
CAGAGCAGAAGCGAGTTGTGGAGATGACTAAGCAGCCCGAGTTAATATCGCAAAAGCTCGAGGAGCTGCGAGAAAGTATTCATAAAATGCATCGTGCAGT
GGAAAAAGAACGTGCGAAGCAAACCCGAAGGAACAAAGACAAGAAGGTTGGTGCACGGAAGGCCAATTTCAGTGTGGGTGACTTTGTGTTGAGGTCTAGA
GTAGACCAGAAACACCAGGACAAGCTGTTGATTACTTGGGTTGGGCCGTACCAGATTGTGCGTGCGGATGTACACTCATTTGTGGTCCGACACCTCGTGA
CTGGTGTAGAAACAAACGTTCACGCGTCTAGACTAAAGTACTACGCGGACAAGGATTATGAAGTGACTGAAGAAGTCAGAGAGCACGTAGCGTCCCAAGG
AATTGTACTATCGGTGGCCGAGCTCAAAGAGCACCGGTGGAGCCCCAATAGGAAGGGTTACGAGATACTGGTGTCTTGGAAAGGACTAGAGCCAATCGAG
GACTCATGGGAACCGCTGTCATCATTGTGGAAGGATATCCCAATAACGATACGAGCGTACGCAACAAGCGCCGCTGACAACG