Description :
From Genome Similarity Track
Location :
Scaffold_3:2463892- 2470899
Transcript NameFunction/comments
Phyin_T30-4PITG_02534Putative uncharacterized protein
Phyin_T30-4PITG_02535Putative uncharacterized protein
Phyin_T30-4PITG_02536U3 small nucleolar RNA-associated protein 18
Phyin_T30-4PITG_02537Putative uncharacterized protein
Phyin_T30-4PITG_02538Putative uncharacterized protein

Sequence
7007 bases(100 bases per row)
CAAACTGGCGTACGATCCGGTACCAAGTCTTACAGCATTATTGAACGAAAGAACAGTTGATCAAACTGCGATGACTATTATGGTGGCGTACCCCGCAACA
AAAAAGAAGAAGCTACACTCCATGTCTTGTTACGAACATGTCGAGATATACAAAATGATTCCGAACGAGGTGGTCCTCCAATCTCCCTTCCGCACACGAG
CAACAGAGTTCATGCAGACAGCCAATCCAGATACAGTCACTGATAAGGAACTACTATCAAAGCGACAGGTGCGTTGCTCAAATTGCGTCGTATTGGCTCC
AACTAATACTTTGGTATAATTCATTTCAAAGACCGACGCTTCCGCAATGCCTACATGTATGATGAGGCGTACGTATAGAGAATCTAGCTTTCAGTGTTTT
TTTAGCTGATCAAACCGACATCTACTGCAGAATTGAAGTTTAATCCCAAGGACACTACCTTCTTGACTGGAGTGGGCATTGGAGATGTTCTTTCCGGTTC
TGGATCGTCGAATGAGGTGAGGCTTTTGCTTACCATTTACTGTCTATACGTCGACTATTATCTGCTGACGAACACGACACACGACCAGCTTCCTGCTGTT
CCAGCATGTATGATAACACGCTCACTAGCAGCAGATTCAAGTGTAAGAAACCGATCAAACCAACGCGTATGTGAACCTGTACGTATTGGCATTCTAACAA
ACTTTCTTTTTTTTGCAGGATCTTCCGACCATGAACACTCGAATGGCCGTCAACGCTCTCCGTTATCAGCTCGATCATCCGTTGACGTCCCACGATGACT
CACAAATCTATCCTGCGCATTCCCAGCAGCCTACTCAAGCTTATATAGTAAGCAAAACTCTCTCAGCTACAACTTGAATGCTTCTCTAACTTCGTAATTG
GCATGTAGCAACGACAACGTCCTCGACGCCCGCTCCCGTCACGAAAAGATTCGCCAAGTCGACGCCATTTTACCAATGGGAGTGGGATTTCAAAGCATAA
AGGTACACTTTGGCTGCTATGAGCGCTACAATCTCCGTCTTTGACATGATGCAATGAAGGTTCTCAACGTGTAGACGACGCTCTAACCGAGTTGAGTCTT
CAAGTTTCAAACACTTGGGACAGACGACCATGTACAATACATTACATACTATTGCTGCTGAGCTTTTTGGCACTAAGCCACTCTTATGTGGTGTGTAGAT
GGAGCCGAACAAGGAGTTGACATAGCGTTAGACTCACTTATCACCACGGCCAACAAGCTCAACTTGACGTATAATTCTCCACCGCAAGGATCTGGACACT
TTAGAAGAGCGTAAAGGAAGTATGCAACGAGCACTCATCTCTATTATATAGCAAACCTCTGACCTAAAACGCCCTGTGTTTGACGAGTTCCCTCTTTATG
TGGACTTGTAGTGAGTCAGTCGGTACAACAGCACACGTCCTCGGGCGTTACCGACTGCAAAGTAGCCGCTGTTCGGACTGAAGTCCATCGCCGACACGTA
GTGCAGTGGCGTGTGCGCCGTTGGCCAGTTGGAGAACACCGTAAGAGACGGCATGTGCACCATCTTCAACGAGTCCTTGGCATCGTTAGAAGCCATTGCC
AGGATCTCCGAGTTGGCATTGAACTTGAGGTGGTCGGCCTGAGTGGTAAGGTGCATCAGCGCCTTTCGCGGCTTGGGCTTGGCCGTCAGACCCGCGTTGT
CGTAGATATTGACCACACCGCTCTTGGAGCCCGCAGCGTAGTATTTACTGCTGGCAGCCAGAGCGTGGTTGCCTAGACTACCTTCATCGTCGTGGACAAA
CACACACCGCCGCGTACGCATGTCCCACTTGTAAATCTGTCCGTCCGAGCCTGTGCTGATCAAGTAGCGGTCGTTCTCGCAGAAAACCGCAGACGTGACA
GTACCGTTCATTTTCAGCGTACCAATGGACTCATACGACTTGGCTGACACCAGATCCAAGTAGCCATTGCTACCCAGGAACACGATCGTCTCTCCGTTCT
CCGAGACAACGAACTTTTCACGCTTCCTTTCCTTCCGTCCATAGAGTCCAGGGATCTTCGTGATCTTGCCTGCTTCAATGTCGTACGAGAAGAAATATTG
ACGAGGTCCGGTCAAAACGGCGCGGTCTCCACCAAGCGTAAACTTGGCGTCTAAGATGGGGAGATCCTGCACGAAGACGTTCTCGATGTTGGCGTTGTTG
CTGCCGTCCACCTGGAAAAGATGCAGCGTCTTGTCGAGACCTGCTGTCAACATGATCTGTCCGTTCGGATGGAACTGCACCGATTGGATAACAGCATTCG
ATGGCGTGTGCTGATTGGCATCCTTCATGCGAGCGACCTCTAATGATCCCTGAGGCAATAGCTCGCCAGAGTCCTCAATCAGCTTGCCAGTGCTGCGGAT
AAGCTCAGCTTCCTCATCGTCGCTGTCATCTGAGTCCACCTGACGGTCACCCAAGAAGTTCTTAGGATCCGCCCACGACACAGCACCGTGTGCTGACTGG
TAGCTGTGATAAGCAAGAAAAATTGAAAAAGAATGAGCATTATGTGCCAATATCAGCGTAGCTGTGGCACGTACAAGGTCTTAAGGCGGCGGTTGAGTTC
CTTGCCGTCTACTATCGTATCCTCCTCGGTTTTGCGGAGCTTACGCAGTTGTGGCTGCTCCTCTAAGTTCACCTCAACATCCTCATCGTCATCGTCCACC
CATGCAGCCTTGAGCTTTAGTGACGCATTGTCCAGTCCACCCTTATTTTTGCCAAGATGCTTGCGCTTATTCTTCTTCTGCAGCGGCTTGGTCTGGAACA
CCTCCTCGGCCAGCAGCTTCTCCGCCTCGGACACCGGTGCACGCTTGCCCATGATTGCAACTGTCAACGCGTTATGTATGGCGGCGAGTGTCTGCACCAA
TGAAACACCATTTGTACCCGTTTTCTGGAACAGCTAACGCTACTTCAAAATGTTGCGATAAGGTGGTACGGGATAGGCGACATCCAGATTGAATACTTTG
ATCAAGTGAATCCAGACATACAATCTTCGAACGGCGAGTGGACCACTGTTTTTCTCAGTATTGAAAACGGAAGGAGAAGCGCAAGACACGTTGGTTGCTG
TTCGTGTGGACGTCCCCAGAACAGGAACAGGCCCCGCAGCTACCCACAGACAAAGCAGATCGACCGCAGGCAGGTGTCTGTGCTCTCTTAACAAGCTAGA
AGCAACCCTTTCCCCGAAAACATGCCGTGCTCCGCAGTAGTCCCCGTGGAGGCTTCGTGTCAGCCCGAGAAGCGTGTGGACTCGCCGCGCACGTTTTGCA
ACTCCCCGTCGTCCATCTCGGACGTCGATTTCAGCCGCAGCTCGACGGACAAGGCGATTCCAGTCATCGACAAGGTGCGCCCCTTCACACATGGGCTTTG
AGATTGTCACTTCTAATTTTGGGTCTTTTGGGTTTTATCAGATTGACAACTCGAAAACAGAATCAGGTGATGAGCTTAAGGCTCAGGACGGTATGCGTAC
CCTGCCCTCGGCATCGGGTCCCCTTGATATTAATAAGGCTCTTGCGCATCCTGTGAGTAGCTCCCAGTCGCTCAAGCGCAAAGCTGAACAAGAGACTGAG
AAGGAGCAACACCAAGTGACTAAGAAGATCAAGACGCAGGAGAAGCAGCTTACGCCCGCTGAAGTAGACAGTGACTATCTTCCTACTGACATTTCGGAGG
ATGAGGAGTGCCCGTATGAGCATCCCGAGTCCTCCGTATCTCGTGATGGCTATGCTGATAATGGCTGTGCTCCTGGATATGATTCCGCTGCTGATGTTGA
ATGTAGCAGCGAGTCGACGCGCCGCAGCCGCCGAACGCTCTACATCGAGTACTGGAGCCGGACCGACGAGTGCAAGGAGCGCAAGTGGGACCACCTTGAC
GAGATCGCCGAGAACTATGGGTCTGCTGAGGAACACATTTTTGCTACGACTCTGAAGGGTAGGACTGCGTTCCTGGAACCCAATATGTTTCCCTATGACA
CTCCTGCAGGGATCGAGCACTGGACGCTGTGGCACGTCAAGGATCTGAACCATGAGCAGGTGAAGAAGTACGTGGAGAACTGGATTGATGCCAACGCACC
ACATGTGGCGAGGTGGAACTATGATGACAACCCGGAGAGGTCCATCGATATCTTTCACGTGCACGTGTACTTCCAGGTGGCGGAGGGGCTTACAGTGCTA
CAAGATCGCAAGGTTGAGGACCTGGTACATGAACTGGACTGACTGGATCCGCTATCGTGTGTGCTACAGGGCTCAGGTCGCTCCTTCACCCCTCACTCTT
TTACTCAAGTCCATCGTAAGTTATCTAGGTAATATTGGTGCTCTCTCGCTAGCCCGAAATCGTTATTTATGCCCAATGGTGGGAATAGCCCATGCTATCG
AACCAAGGCGAGGCAAGAGGCGAGTGGAACTACCAGCATAACCAACCGGTAGCGTTGCAGTTTGCGTTGCATCCTCAAACAATAAACATCGCAATACACG
TCTTTACTAATAATACGTCAAGCGTTTGTCGTGAGATGCTACAATCCAGAAGTAGGCATTTCGCTATTATCTCTGTCATGAGTAGCGACAGTAGCGCCGG
TGCAGTTAGTACGCATGGTGCATCGTGGCGGTATTTCACGAACAAGCAGAGTAGCGTAGGTGATGACAGTGACCACGAGACAGAGGGCAATAACCAAGAC
GACATTGACGATGGCGAGTTTAACGAATTGGCGGCGGAGACGTCGAGCTTGGCATCCAGCGAATGCAGCAGCTTCGTACGCCACGAACAGGCCACAATCA
CTGCCATTCGGGTCCGACCGATGCGGATATCGGAGAAGAAAAGTGGCAATCGCGTCATTGTCGACATGACCAGGAATAACGATGTTTTGGTGACTAGAAT
TGTGAATCCGACAGCACTCCCGCCTGCCTCCCGTACTTCATCTACAGAGTCGGTAAACTTCCCAGCACAGTTCACACAAGAGTTCTGGTTTGACTATAGC
TACTGGTCTTTCAATCGTTCGCCTGCGTACCAGAAAGCCACTCAGAGGACGCTTTACGATGCGCTTGGAGTGCTGGCGCTTCAAACGGTGTTGCAAGGAC
GCAACTGCTCCGTCTTCGCGTATGGACAACCAGGAGCGGGGAAGACGTACACCATGATGGGAAGTTCCTGCGCCAAAGAAAATGGCAACGAAAGTGCACT
TGAACGACGGGGTTTAATCCCACGAATCTGCCAGGGTTTATTTGGTGAAGTCGACGAAAGAAAGCGCTCTGGAAACGTATGTACAGTGCTCATGAGCTAC
GTAGAAATCTATGACGAACGAGTCTATGACTTGCTCTCTCATGATACAGTCAAGGTGAGTCGTACTCTTCGATAGTTTTACTTCAATGATACCTGAACAT
ATAATGCTGTTGGTATAGCAACCTCTTAAGATACGCGAGCATCCAGAAGATGGCGCTTTCGTGGAGCGAGCACAGCGTGTGGATGTTACAAGCTGCACGC
AACTCTTGGAGCTGATGACTCGCACGAGCTCTGTGACTCCAGTGCAGAAAAGTGGCCACCCTACTCGTTCTCACACCGTGTTAACCATCTCTCTCATGCT
AGGAGGTGAAGACCCACAGAAGAGCAAGCTGTGCTTGGTAGATTTAGCTGGTAGCGAGCGAGTTGACCACTCGGGTACCCGTGGATCACGTCTACGCGAA
GCTTCCAGCGTCAACCGCTCCCTTGCGACGCTTGCAAACGTTGTTGGGGCTCTGGCCAAGTGCAAAAGCGATGGCTCTCAACCCCAGAAAACGTTTGTTC
CCTACCGCAACTCGGCACTGACACGGCTACTGAAAGACTGCCTTGGTGGACGGGCGAAGACTATCATGATCGGGGTTATTAGTCCGTGTAGTGCACACTA
CGAAGAGTCGATCGCTACGCTCAAGTGTATTGAACGTGCGAGGAGTTTGCAAAGCACAGGTCGATTACAAGCGGACACTAGTGGAAATACACTTCTGAGG
TTCTTACAGGACGCTGACGAGCTTAAATCCCATCTTTGTGCGTCGAACGAAGGCAATATCCCGCCTGCTGTGTCGTATGGAGAAGGTCCAGAGCACAATG
ACGATTGTCCGGGCTGTGAATCATGCGATGACGCAGACTCGACGCAAACTTCACTCGAAGCAAAAGCAGTGGAGATAGCAAACACTAAGCAATGCGACGA
TGCAGAGTTGGAATGTAAGCAGACACGCTTGCCGATAGAACTGAGTGTGCATCTGATGAGTCAAGTTGAAGGCAGTGTTTCGCCTCAAAGATCTATTGGA
CGGAAAGCAGGTTGTCCTCCACTGCACACGCGTGTATCGACAACTGAAGTGCGAACAGCGGATCGTGTACACGATGTTGTAGCGGCAGTTGTTGCAACCG
ATGCGATTTGCTGCTCGGTGGTGCAGGATTTCATGTCTTCACACCATCCAGAATCGCAGGAGGCAGCTCCAACATCGCTCTTGGAACAATTGGCGTCGAG
CTCGGAGTACAATCGGTCCGAGTTTTGCTTCGATAATAGTGGAGACGGCTGTGATCTGGAGGAATTGGCGTCACCTGAAGGACAGGACGATGTTACAGAG
AGCGACAGCTTGCTGTCCTCGATATCGTCGAAACCTTGCGATGAAGAGAGCAGTATCCAACCGAAGCTATCACTTTGCTTGGATTCGATCGACATGGCCC
GAAGGGCGCTGGGTCCTGGCGTGTATAGTCTACAGAGCAACAAGATGATGACGAATGGAAGTGGGGTAGAATGTGAGCTACTTCGGTACCTGGACAAGCG
ATTTATCGCCATGGAATGGAGTTTTGAAAACCTGATGGTGGCGTCCCAAGTGCAGCCACTAAGTGCGCTGTTTTTATCAACAATCGACCTTCTGGAAACA
ATGGTAGGCGAGTTCTGCTTGCAGATAATCCCTACGCTATGCGATCAACTTCCTAGTGCCTCTAGCGCATGTGTAGCTGGCCGGCATCAGCTCGAGACAC
AGTTGGA