Description :
From Genome Similarity Track
Location :
Scaffold_19:2463- 9897
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.15Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.50Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
7434 bases(100 bases per row)
AGCACAGTCATGAGCTCCAAGGTCGGAACACCGACCCCGAGGACGTGCACGAGCGCTTGGCGAGCTATAGACACACAAAGTACATCAGAGAGTCAGTACA
ACAATGCACAACATCTTCCCCATCATTCCAATCGCATTCCTCACTTTGGCCGATCGACAGTCTTCCACTGTTCGTCGCGTCCGCATTTGCAAACGCGGTC
CACAGCAACTCCATGGGATTGTCCACTTCGTCATCCAGGTCGTCGCCGTTTGCACTGTCGCCGCTCGAAAATCCAAAGTCGCCACCGTCCGAGTCGTCCT
CGTCCTCATCATCTTTCTCGTTCAGGTGGGCCTCCTGAACTGTCTCCATGTGAGCGACATTCCCCATCTGTCCAGCTGCTGCTCCTCCAATCGATAAGCG
TCCTCCTGGACTCTGCAGCAACAGCTTCTTCTTCATCTCGCGCGCTTTCTGCTTCTCGAGCTTCTTGCGCGACCGTGTGGCTTTGTACGTAGCCACGACC
TTCTTCTGCACCGCTGCTTGCTGCGCGATCGTGTCGTCGTCGCGAGGATCCACGACCGTGTACTGGTCCTTGTTCGCCTCGCGCGCCTCCTGCCACGCCC
TCCATTGCTCAATTGCAGCGTGCATCTCCAGCAGCTCCGAGCCATTCAGCGGCTGAATTTGCTGGATCTTGCGGACAACCGTGAATTGCGGGCGCGGGAG
CTGGACGCGATTGATGTAGGAGTGATGATGACCCTCAAGGTACTTCGCGGCAGCATTCACGGGTTTCTGCAGGAGTTTTTCAAACTCGGCGTAGAGCTTC
GGATCGTTAAACAATACCGTAGACCTCTTGACGCTCGAGCACTGCAACTCTTCAAAGAACACTCGGTGTTGTGTCTGGGCTTGCTCCTGGCCATACGAAT
TCTGGAAACCCGAGTACACTTCTTGTTTACGAGATGCTACGTCCTGTTGACGAAGGTACTGCTCGATGTCGCGCGGTCGCAAGATCTCTCTCCCTGTGCC
ATCGCCGTTCAGAATCAGTAAGTGCGGCTCGATCGGGTCGTTCACGATCGCTTTCGCTGGGATCAGGTTCACCTCGTACTTTGCCGCGTCTGTGTCGCTC
ACAACTCCTGCCAGATCGATCGAGACCCTAGGCGTGACCCCAGTACTGTTGTTACTGCTGCTGACAGAGCTATTGCTATTGTCAACAAAGTCGATCGCAA
ACTGGTTCTGCTCGTGGTCGCACAGCTCGAATTTCCCTCTTGCGCAGTCGAAATAGTATACGCCATTGTGGCTCGTGATATTCAGATCGTCGTCCTCATT
GATCGTCTGCCTTGTGCTTCCGGTAGCAAAAGCGACAGACCGAGGCGGCTGGTACTCGATGCGCCCACTGTCCTTTGCGACAACGCAAACCCCATCAGGC
TTTCTCGTCGTCACGCGGCCGTTCACCTGCGCAATTACCTTGGTGTTGTAGCTCACTTCAATGCGGGTGCCATCATAGACATCGACGATGCTCCTGGCAC
GCAACCCGCCTTTTGTCACCGCCACGCGCTCCCCCCTTGCGTGGTACTGTGCTGTGAGGTTCACTTGAATATCAATGCAGACGTCAGCGAACCCCACTTT
CTTGATCAGTACGTGGGACTTGGAGCTGTTGGTGAACATGCGCGTGCCGTCAGTGTGGTGTGTGACCCTGGATCCATCTGTGTGGATAACGACGACCACG
CCATTTGGACGCTTCTCCACCAATGCATTTGTCGCCGGGTCCACAACGCGTAGGGGTTTTGAGTCCAGGTCTTCATCGTTACCACCGCTAGCCACTGCTG
TTTGACCCATATGATGGACATCACCATTCGCGAGCAGCACAACTCGTTCGCCACTAGCAAATTCGCGCAGCACGGCGCCTTTCCCAACGATCAAGCGGTA
GATTTCGCGCTCTTTCTTGCCATCATCTTCTCCCCTTTCACCACCACGATGAGGCTGCTGTTGCTGGTGTGCAGAAACGTACTGCTGAACAATGGTGCCA
TCCGAGCACGCAGTGATCGTCAATCCATTTGAAAAAGTGTTGCTCGCCGTGATGGTCGGGAATCCGTCGGGTTTCTTGCGCAGCGAGCGTCCTTCAAAGA
TGTGCAGCTGGGAGTTGTCCTCAAAGGACGCACAAAACTGGAGCATGTGGCTGGAGGGCCCACCAGAGCCTGTCGGCTGATGTTTCTGCTTGTCGATCTG
TCGAAAGCCAAACACGTCGCTTCACAAGTGCACACACATCCACAACAGAGTCCAATCAGCTTTAATACCCCTTCGTGCTAGGACTTTGAGACACATAGCT
CTCTCTTACCCTCCTTGGTAAACGTTGAGCCACGTGTACCCTCTCGGGGTTTGATAAACTCGGATCACGCTCTGGTCCGATGGAAAGAGCACGGACGCTT
TCTCCGATATCAGACTCAGTTCCGCTGACGAGAGCGGTACGCAGGTACCCAACGCTTCCGTTGTTCGCGGCGTCAAGTACTCATCGGAAACCAGCTGCTC
TTTTCTCCAGTCCTTGAATGTCGGTCGGTGGCGGACGTGGTCCTTGGCGCTCCAGGTTGTGGTACGGAACCTTCCGGGAGCTGTCGCCGCCAACGTCGCG
ACCAAGAGCGAGTCGGTCGCCGAGTCGTAGTGTTTGTAAACAGTAGGAAAATTGCCGAGGATTTGCACGAGTCGCTGCGGGAGAATGTTGCGGTCCAGCT
CCTCGACAAAACAGCGCGTTTGCTGCAATTTCCCCTTCCAAACTGGACCCAGGAGCATCTCGAACTGCAGCATCTGGCGCGCCAAATGCACTTGTGGGAC
GTTGAATTTGCAGCATAACGCGAACTCTGTGTCTTGAACGCTGCGCTCAGTCGGTGTCAACTGAGGCTTGATTGGCATACCCTTCCTGCCGCTGTTGCCC
ACGCCTGGGAGGTCGCTGAACGCCCACATCTCCTTCTCCACTTCATCGATTTTCTTGCCAAGTATACTGCATGGGTCCCCGCCTTTGTTGTTGTTTTCTT
CTATGCCTTGGTGCTCGGTAAATGTCGTGTACGCCACAGCGAGACGCAGCGCAGCACTGTCATTGTACGTGATGAACTCTTCGACATATGACTGGTTGTT
GCCGAAACCGCTAGTATCACAATCGCCACCACCATTCTCTGTTTTTTCAGCTGTAAGCACAATCGCCTCTTTCATCGCAAACAGCACAGTGCTGACGCCT
ACGCTAGCTTCATATACTAAATTCAGGGTATGCTCGTAGACGCCAAGAGCTCTAGCTGCGTCTTGGCTATTAGGGTCGTACGCTGGGATCTGGATCATCT
TTGTTGTCAACACCCAGTGCTTGAACTCGTACTTCTGCGCCGCAAGCGCTTCAGCGTTCACGAGCAGCTCCTTCACGAGATCTGCAAGCCCTTTCGGTTC
TTTTACAGCGGACGAGCAAGGCAGGTCGGCAAACACAAAGTCGCTCCACTCGAGTCCACCCACACTCGACGCTTCGTAGCACTGACTGACGAGAACGTCC
GCTATTTGGAAGACCGACGGTACGGTATTCGCGGAGCCAAGCGAGTCGTCAACAGCGCTGTTGATGGCGTTGGCGACGATGTGCTTCTGCGAGATGCTCT
TGCGACGCTCCTTTGAGAGACTGACTGACTTGCGGCGCTCGCGGAGGTCTTTCGCGGGGTCCGCGATCAGCAGTATACCGTCGATCAGCGGCAGCAAGGG
CAGTCCGCCTTGGTATAAAGCGGGAGACGATCCTGCTTCACCTGTGCGCAGAAGCGCTTGCATTTCGTCCAGCGACGACGGGTATTCCACAAGGAAATAG
ATACGCGCTGGCGCAGTTGCACCCATTTGAGACTGCTGGTTATTGGCTAAGAACTCTGCTAGAGGGCTGCTGGATGGATCGCTAGAGACGGCTGGGGTTG
TCTCGTCCGCCTCCGGTGATACTGCAGCTGCTGTCAATGAAGAAGATGTCGCCACCATGTGCGCTAGGAACGCCATCTTGTCTTCGTGTACGAGTCGCTG
GAACGCGCTTGCTAGGATCTGTGGCGTCAGCTCAAAGCTGCCAAGCTGCGCGAGATATGGGTTAGACTGGATCTGCGTGTTTGACGACGACGCGCCGATT
GACTTGTGGCTACTACTCTCTGCTAGTGATGTTACTGTTGCTGACGACGGCTGGTCTCCTCCTTCTAGCTGCTCTTGCTCACCATTGCCACTGCCTTGAA
CGTGTTCTTTGGTTGCAGCTTTCGCAGCAGTCGCTGTCTCAAGCTCCTCGCTTTTCGTCTTGCGAGCGAGCGCTTCCACGTCGCTGCGGTTCACGACGCG
GAACGAGCAGCGGCGCGTCCAGGACGCCAGAAGGCTCTCGCTTGAGAGGAGCTTCAACAGCTCGCTTTTTGCGCTGCTCTCCAGCTCCGACGCGCCGCTT
GCGGCCAGCAGCGTCTGGAAGCCCCACGTGCGTGCAGCACCTGCTTCCATCTTCATCACAATCGAGAACTGAGTGTCTTTTCAAGAATTTATCTGAGACC
TTGCTGGTCTCAGATTCTGCTAATGATTCAAAAAGGACTCAGATGGCCACCTTCCATGATTCTCAGATTTTCTTTCATCACTTTCCAAATCGTCAAGCCA
CGAACAACGGGAACAATGATCTTCAAGCTCGTGCGCGCAGCGCTTCTGGCGGCGGCACTGCTCGTAGACACAGGTGAGAGCAGAGCTAGTAGTCGTTGCC
GTGGAAGTGCGCACTTGCAGCGGCTGTTACTTGCTCAGCCCCAGCAGCAGCAGCAGAGCGCGCCGTCCTGCGACGAGAACGATCTGAAGCGTGACGCCAT
GGGGCTTCTCACCGCGCACTTTGACGTGGAGCTCGGCGCCGTCGCGCCTGGCGACGCGAAGCACGTGGGCTTCCAGCACCTGGTGAGATGCTGTTCGAGT
TCGCTGCATGTGGTAATGCACATGTTGTTTTTACTAACCATGTGTGCGTGTATATGCATCGTGGCTTCTTATAGAAAACCGCCGACGCGCTGTTCGCCGC
GCAAGCCATCGCTCACGACGACTTTGATCGCGCTGCCGAGCAGTTCCGGTATGAAACATGCAGAGCGCGCATTACTAGATTCACTCTGAGTCTTGTTTGT
TTATGTGTGTATGTGTATATGTGTGTGTACGTATATGCTTCTGTTAGAAATGTGCTCAAGTACCAGCGTGGAGACGGACAGCTGCCGCACATTGTGTACG
GCGCCTCTGTGCCGTCGGGGCTTGTGTGGCTGAGCACGAACAAGACCTTCTACCCTGGACCAGCGTTCTGGAGCAACAGTTCAACTGACAGCGTTAATGG
AAGTGAGGATGGTGACGATGACAGTGATACCCCACCGCTAGTGACGTCCAGTGTGCTGGCGCCACCGATCGCCGCCGACGTCGCGTGGCAGATCTTCCAG
CTCTCGCCCTACGAGATGGTACTCGGCATCGTAGGCTACAAGGCGAACGCCGTCAAGTTCCTCTGCGACGCCTACGAGCCGCTGAAGAAGCTGCAGGCGC
TGCTTTTAGAGACGAGAACAGCGAATTCTAGTACTAGTACTACGGGCGACGGACGGAATCTGCTGCTTGCGTCCCATGTACGTGGTCAAGAGCAAGCTTT
TCGCCGTGGGGAGCATTGTTAACCCTGTTCAGATCTAACGCACTTCTTGTTATGGCAGCACCCGTGGGAGACGTTCTCGTCGCTGTCGCCGCATTGGATC
AGCTACTTAGCTGAGCTCAAGAGCGCAACAGACTATGCGGACGTGATCAAGACGGTCCCGCAGCAAGCCAAGGCGCGGTTCGTGGCAGGCGCAGGCTCGC
TGTACTCGCCCGAAGTCGCAGTCAGCAGTTTGTACGAGCCGATGATCTACTTGGCGGAATGCGTGCGCAAGACTCTCCACTCAAACAGCAACCGCGATAG
CAACGAGGTTCCGTGCGGATTCCAAGTCTACGACATCGAGTTCAACGCGCTCGCACTGCGGTCCGCGCATGCGCTCGTGCAGATCGCACGTGTGCTGTTA
GACCAGTCGTCCGTCTGCTCTGAGTTCAAGCAGAGTCGTGAGGAGATGCTCGCCGAGATCAATGCGTTGCGCGCTGTCGAAGCGAATTTGAAGGTCACGA
TACTCGGAGGCAACAACCAGAGTAGTGGACTCTGGAACTCAACTACTCAGGTTCGGATGTGGACTTTGTTGGCACTTTGATACGTTGACGCTTCGGGTAT
TGGTATTGAGGATCACTAACATTGGCACTTACTTCCTATGATGTGGTTTGACAGTTCTTTGATGACTCGGCGACGTGGTCTCCCACCTCCGTGCACTCGC
TTCGCGGTATCATGCCTGGGTACGCTGTGAGTCTGCCGCAGACCATGAACATGGGCATCGTCGAGCACTTTCTGGCGCCGTCCGAGTCGTTTCACTTCTT
TTGCCACCGGTTCCCCGCACCGTTCTTCACGTGCTCTCCGGAGCTGGGAGATTCGCAGAAGCAGACGACACTCACGCTCTACAACTACTTTGCGCAGCGC
GCGTTCACAAACGTACGTACATTGTGAATTCAAGGTGCTCTGATCGTATACATGGAGTTCTAATAAATATGATTTATCCGTAGAACGAGTTTCCTGGCAT
CGCCGAGTACATTCGCAACAAGACGCGTGACATGATCTGCACCGCGTCGGGCCGAGCCACTTTCCTGTACGCAGTGGCAGAGGACGAAAGTCCTTCCTCA
TTGCCTCCCGCGCTGTTCGCTCTCGCCTACAACTCGAAAAGCGCTACGCCAATTGGCAACTTCGAGGACGGCTACGTCGGCTCGACGCTCGCTGCTGCCG
CGTTTCTCAACATCTTGCTACCAGCAGGTACCTTGTGCTCCTACATTATCCAATTTTGGTAGACCCTGGGTGCGTGAAAGCTAATCTGTTTGTACACTTT
GTTAAATTGCAGTCGCTGCGCCGCCAAGTCCGGATGCGCCGCCAGTCGACCACCGCATGCTCACAGTGATCATGGTCATCGAGCTCGTCGTGGCGTTTGT
GGTTGCGCTCGGCTGCTTCCTCTTCTCGGTCTACTTTGTGATCAAGCGACCGCGTGAACCTGAAGAGCAGCAGCCGAACGGTGGAAGCACGAAAGACAAA
CTCGGTCGTGTGGCGTCCGCACGCAAGCAGCAGGCGCGCGTGGACTCGGCCAACCAGAACAACAGTAGCAACAAAAGAGCGAGCCAGTGTGATCGCGACG
ACCAGGGATATGATGAGAGCGGTCAGAGGTTGTCGTATGGCGACCGCGTGATGTACTCGGACCTGTCAGATTTCGAGAACACGCGCGATCTGGAGGAGTC
GCTACTCTCGGACGACGAAGACCTGGTCTACGGATCCTTCGAGTCAGCGGACCGTGACAAGCACCAACACGAACAAAATGACAACACGTCGTGGAGCGCT
TTGAAGGACGCGCTCGCGGCGATCAGTCCATGGT