Description :
From Genome Similarity Track
Location :
scaffold_292:2462- 13317
Transcript NameFunction/comments
Pl_106488pre-mRNA polyadenylation factor, putative
Pl_106489hypothetical protein PHYSODRAFT_553661
Pl_106490conserved hypothetical protein

Sequence
10855 bases(100 bases per row)
ATGGGTCAGCAGAACTGGAATGGTCCTATAGGTGGCGCACCGTGGGGCTCTGGACCAGGAAGAGGACCTCCATGGATGGGAGGACCTGGTGGTGGAAGAG
GTCGCGGTGGTCGAGGCGGCTTTGATGATCGAGGTCACAACGGCAAAGATGACCGTAATGATAGGCGAGGTGGTCGATCAAAAGAGGAAAGTCGTGATCG
ATCAAGATCTTGTGAGCGTTCTCGCCGCGATGAGTCTCGAGGAAAGTGGGCGCCAAGACGGTGGAGGAAAAGATTCTGACGAGAAGGATCGAGGCCGTGA
CAGGGACCGAGAGCGTGGCCGCGACCGTGAACGGGTAAGTCGCGATCGCTCAAGGTCCCGCGATCGTTCTCGCCGTGATGAATCTCGAGGAAGTGGGCGC
CGAGATGCTGCTGGAGGAAAAGACTCCGGTGAGAAGGACCGAGCCCGAGAAAGAGACCGAGACAGAGACCGGGACCGTGGCCGCGATCGTGATCGTGATC
GCTCTCGCCGCGAGGAATCGCGAGGAGGTGCCCGTCGAGATGGACCTGGAGGAAAAGATTCTAGCGAAAAGGACCGCGGAGGGCGTGGAGGAGACCAGGA
AAGAGAACGAGGGGGACGCAGAGGAGACCGAGGTGGGCGATCGCGATCTCGAGACCGTGATTCTCGCAAGCGTAAAGGTCGAGATGAAAGCTCCGGAGGA
AGCCGTGGGCCTGGCAAACGGAGGCATTAGAAACAGGAAGCAAGCTAGTGGAGTGCTACCATGTATCGAGGACAAGTTGTTTTTCCAAGATACCAATCAT
CTAGCAAAGATAAATAGCGAGTTGCAGTTATACATTGCTGAGTCACCCGGTTCGTGTTAACTTTTTGCTATCTACAAGCCTGTGATCGCAGTTGTTGTAA
TGTTTAGATCTGCTTGTGCAGCCAGAGCTCAGTTTCCAGCTTATCTAGGTCCTGTGCCGTCACCTGGAGCGCAATTACGGCATCACTTTGGAGGGCGTCG
ACTGGAATGAAAGTCATACCAGGCATACTGTTTGCCTTTCCTCGTGCGGTAACAATGTCGTAGTACGCCTTGGCCAACTCCACCTCGCTGGAAAAAGCTG
TGGTCACGTAGAACGTGCGCACATGAAGCACACGGTCCCAAGGCATAAGTGCTTGCACCAAACTATCCAGCATGTTTGTCCACATTCCCTCGGCAACAGC
TTTAGCCAAAATTCGTGTATCTGCGAATTCTTCATCGCTTTCGATTGATGCTGTACATATAATCTGGCAAAGAGCACGCGGGACCATACTGCTCTGCCAG
TCGAAGCGGAGATTGTTTGATAGGCTTGTGCGTGTAAAACTGCGGGGTACCAAGTATTTCAACGCGATGTGCGTGAGTGCCTGGAGCTCCACTTCCACGA
GTGCATTTCGCGGTAATCGTGACAGCTGCACAACCAGCAGTGGTGCCTCTTTCACAAACTCCAAACGTGCTTCACTCTTGTCAACTTCTTCGTCGCTCTC
ATCACTGTCGTCAACAGCCTCGAATTCATCGACCAACTCGGCGTTGCTAATGAGGTGTTGACGGCTGTCGGCTAGTAAGCGTTCACGAGCCTCACGGTCA
TCTGGATTTCCGGTGGTGTAGATGACACCAGAGCACACATGCCGGAGGTTCGACTGCAGTGCTTCCAGGACACGACAAACATTGCGAAAACATTGTGTCG
TCTGAGCTGTGTGGTCACCTGGAACTAGGTCCATAGTCTGAGGGTGTAGAGCGATTTGTCCGGCCAACAAAATGAGCGCTCTATGGAGCACATTAGCTTG
GCTATATGGACCAATGCAGCACGGTGCCCAGGCCGATATACTCTTCACATGCAGAACATCGCGACGCACGCGCAGTGACTGCAACTTTTGTTTGCCACTT
CCACGCAATGCGAAGCAGTCCAAAAGCACACGCGCCGGTACATTTGCCAATGCCTTCACTTCTACACAGCTGCGGGACGGAGGCAGGTGTTGACCGAGGT
ACCGGACATACTCAGCATTGAGTTGTCCAAATGTGGACATGTCCTGCACGTACAAGTGGACAAAACATACGTCGGCTAGCACCATGTTTTGATTCTCGAG
GATAGCCTTCAGCTGCGCAACCACATCCGCCATTTCTTCTTCTAGAGAGATTGACGTATCACCAGCCTTGCTGCTCATGATGCCCGAAAGGTGCAGTTGG
TCGCGAAATCGGCCAAAGTCGGGGACAACATCTCTTGCAGGTTGTGGGGTAAGTGCAAGCACGATAGCTGGCTTCTTGTCCATAGTTCTTTCGCTGCTAT
CTGGTTGGGAAGCTGAAGGCTCTGGAATTCTTGAAGCCAGGTGCGATGGGTCGACAGGTTCCTTATCCTCAAGATGGCACTTGTCGATCGACAAGAAGGC
CACGGGCGCGATGTAGTCATCCGAATGAAGCACTGTGTGGCTTTCATCACTTCAATAGCAGAATTTGTACTACAGTGTTAGATATTCGAACAGCAAAACA
TATCATACCAGAGAAAGCAAGCTTACATGATGATACGCTTCTTGAATAACGGGCAATCCAACGTGAATGTCTCGTACTCTCCACCTTCACCACAGACATT
CATCTGATACTTCTCTTTCTACACAATGCACATAGACATCACACCAAAAATTGAACAAACAGTACGCCATCATCTCAATCACGCTTCACCTACCAGAGTC
ATGAGTTGTGGCTGTAGTTCCGCAATAGTCTTTCCTAAATGCCTCCGTGGTTGCAGTCCAATGGACGCCACTTTGACCAGAATGGCCTCCATCTCCGAGT
CAATCATCTCCTGCAGCAACTCAGTCTGCTCTCGACGCCACAAGTATCCAAGTGACGTCAATCCAAGTCGTGTACATCTATTAGACACAACAAGTCAGCA
CCATCTTCACTTCTTACAATCCTATTGCACGCACACATTCTCCACTCGATTGCGCTGGTAACTAGAGAAGATTGCACCTGTGCAGACGGCCTGGACATCC
GGGAACTGCTGTTGAACCTTCTGCAGCAGGCGAAACAGGTCTTCAACCTCGTCTCCAGCCGCAGACTCGAGGTAATCGATGTCCGTCTTGACTGCAGTGC
CTGTGATAGTCTCTGAGACTAACGGTAGCTCCATACTCTCGGCAATGAGCCCCACAGACTGGTGCCCCACGCTCTGGAACATGAACGAGTCAATCTCGGC
ATCGTCCGACGACAGCTCCGACGGCGGATGGAGATGCGCAAGACACACGATCTCGTGGCCGAAGCGCACGCACTCCATCATGGCGTAGCAGCTGTCCTTG
CCGCCGCTCACGAGCGCCACCACCTGCATATTTACTTCGGGCTAGGATGGAAAGTGACGCAGCATTATGCGTTGGTCGAGAATAGTGTAGCCATCTCAGC
TCCATCTGATGTATGTATGACACATCATTTGATGTACAAGTCCAGTTTAGATGATGTGTTTCACACCATATTGATGTGCAACACACCAAGATGTCGTAAT
GTTGCGTCACTTTTCAATAGAGAACCCTTTGCTCACCGAGATGGCGGCAGTGCGGTCCGTGCTGCTGAGCGACATCCAGAGCGTATTAAGTCTAGTAAGA
CGACGTCATGGCTACCTGCTGTCAGGGGCTAGCGGACAGAGGTCGAAGCTGGTGCGTATCTGTCCTTTAGGCTCCGTGATTCCCACTTTAAGAAAGTCCA
GAACCTCTAACCACCTTGTCATTATGGCTACAGGAGAGCCCCCTAACCGTTTTCCAGAACTTCTCTCTACTGCGTGGACGTCTGCTACGACACGAGAGTG
GGTTGACGCGCTCGAAAACAGCTAAATCACTTCATTTTGACACTTTATTGACTTTTTTCGATGTATTTTGGACAGATATGGCGGAATTGTCGCCTGTGAA
CGTCGTGAAGCCCTTCCTGGACGTGATCCGCCATGAACATGCCAGTAGTACAGTGACCGGAGCTGCGCTACAAGCGGTGATGAACTTTCTGCACTCGTGG
CCGTGGACTGAGACCAAGGACCAGAATGCAGCGGCCGACGCTGTGTCTGACATTGTGGACGCCGTGAGCCACTGTAGATTCCAAGAATCAGGTGTTGAGA
GTGACCAGAACGTGCTGGTGCTGGTTGTACACGTACTGCATGCAGTGGTGCGCTCTCCTTGTGGTACCAGACTGTCAGATCACTCCATGTGGCAGCTGGT
GGAGTCGTTGTATGCACTTAGTCGAGGCGATCGACATGACGTACGTGCTCTTACTGGTTAATTTCTGTTGTGATTAAAGGGTGAATGCTGACGATTTGTT
GTGTGTTTGTATAGCCACATATCACACTGCCATTGCGATCGACGGCTACGAACTTTCTCCATGACACGGTGGCTTTCATCTTTTCGAACCCTGCTATCTA
TTCAGACTTGGCTCCTGCTGTGGAGCTTACAGCTTCTTCGGAGCCACTGAGACCAGGATTTGGACTGCCGTGTGCAGTGAAGATCGTGGGGTTTCTCTGT
CAGAAGCTGCACCAGAAAAACTACGTGCCACCTCCCCCTCCAGACGCACCTGCCACTCAAACTGGAAACACCACAAGTCGGCGTGAGGTGTTGTTGTCAT
TTAGCTTGCTTCAGCGCGCGCTCATCGCGTGTGACGCCGAGTTGATTACGGGCGTGCCGTCGCTGATGCTTTTCATCAAGGACGATCTGTGCAGTGCCAT
TTTACGCTACTGCCGACTAGGGTATGTACTGTGTGGAATGCCTAATACCTTGTTGTGTTGACCTAACTAGTTGTATGTTTGAATAACCGGCAGTGCATGC
GTGGAGCTAAAGATCCCAGTGGTGTGTCTAGAGCTGATCAGGCTATTGTGGTCAAAACTCCGCTCGGAACTCAAGATGCAGGTGGAGGCGCTTTTTAACG
GTATATTCTACCACACACTACACTGGTGTGTTGCAAATATGGATGTAAACAACCCAGACTTTCCACGTGGAGATGATGCAGCCCCGTCGGCTGAGGCTGT
AAATGGTGAGACTGACGACAAGCCTGTTACGATGGTTGATGCCGCCATCGATGAGTTTTCGGGGGAGCTTCTATCCAAAAGCCGGTTGTACAGCATCTCG
TTTGAAATTCTCGATTGTTTGGTGGACTTGCTTGCGGAAGCTACACTGCTGCCTGACTTGTATGTGAACTATGATTGTGACGGCAATCGTTGCGATTTGA
CGCAAACTTTATTCGAGTTGTTATCACAGGCTGCCCAGCAGTCTCATGTAGCTTGTTTCGAGTCGCACGAAGAATCGCATTTCCTCTGGGCTCAAGCAGT
TGGGGAAATAGCTCTTCGCGGAATGTTTAATGCACTATACGTTGTACATCTTCGTACACAGCCGGAATTGCCTGCTGCCAGTGGTGACAGTAGCAATGGG
CCTAGTGATGAAGAAATTACTGATGACACGCTATTAGTTGGTCAGGAAGAACAATTTCCATCAGCAGATACTGAAGAGTTTGCCTCTGCGGAAGTATTAT
TCAAGAAGCGGCAGCGCAAGAAGTTCTTTCAGCACGGCATCCAGGAGTTCAATCGGAAGCCATTAGCAGGAATCAAGTACTTGCAGCAAAACACCTTTCT
GCCTACACCGCTGGACAGCATGTCACTTGCAACGTTCCTGCGGTCTCTTCCTCAAGGTCTGAACAAGAATGCAGTGGGTGTGTACTTGGGCGCGATGGGC
AAAGAAGTTAAAGGCTTCGAGAAAACAGAAATTCACGAGGCTGACACAATGGACTTCCATCGCGATGTTCTTACCAACTTCGTGCGCTCGTTCAACTTCG
AAGGGGAGAGTATTGTCGCTGCTTTGCGCATGTTTCTCGCAAGTTTTCGCCTTCCTGGTGAGGCACAGCAAATTGACCGCATCTTGAACACCTTCTCTCT
TCAAGTGTATGAACAGTGCCGGGAACGATTTCTCATGGCTTCAGTGGACGTAGCATACTTACTGTCGTTCAGTTTGATTATGCTAAACACAGATCTGCAC
AACCCAAATATCCGATCAGACAAAAAGATGAAGCTACCCGACTTTATCAGGAACAACAAAAACTACGGACTGGAGGTTTCTAAGGGACTAGATTTGCCTG
AAGACTTTTTGACCGAGTTGTACAGCACCATTTCAAAGGACGAGATCAAGACGTTTGAAGATGGTGGTAAACACGGTGAAGTAACAAGCGATAGATGGAA
AGACCTGCTCAATCAAGCAGAAAGCAACCCTCGCAACTCACGTTTGATTGTGCACCACCCAGCATTGCATCTCCGATCTTCAAGCACGCCTCGTGGCATT
GGCGCCCAACGCACATTGCCATCACCTCTAGCACCTGACGCTATGCGAACGATGAAACAAGCTCGACTCACGAAAAGTGCATCCAGTCCAGCTAATGGAG
TCACTGCATTAACCAAAAGTGGAATTTGGGAGCAGCAAGACGACTTCGATGGGCTTGTACCTCTTTGTGCCTCATCAGGTAACCAGTATGACCGCCACAT
ATTCGAGTTGATTCAGCAGAGTCTCGTGCGGGCATTCAGCAGTGTATTTCAGCAATTTGTCGTGGATTCACAGGCAAAGGATGCAGCACGGGGCGAAGAT
CTTTCGGTCGGTAGTAATTATGAGATGCACTACGTGCCCCAGAAAAGCGCGCTTCAACTTGCTTGCAACGGCTTTGTGCTGTGTTCCGCTGTGGCATCTC
AGTTGTCATTGATTGAACACTGCAATTCGCTGTTCATCCGCCTTTGTAAGTACACGGCGTTGATTTCGTCGGATATTTATCCTGTGGGATACAACAGTCG
CGAAAACGGTATCTGGGTTTATTGTGACAACCAAAGTGCCCCGGTCGCGACTGCAGCGGTGCTTAAACTCGTTAGCACGTGCAGCTTATCACTTCACAGC
CGATCGTGGAAGTATTTTTTTCACGTCGTAAGTGGTTTACGTGAGTTTCACGTTTTGCCATCTCGGATTCTGTACCCCAGTGAAGAGATGAAGCTGGAGC
TAATGACACATGATGAACGCCTTGAGTTTATTGACCTGGTGTATCAGAACAAGGAAGAACTGGAAAGGAAGATCGCGCTTAGCGCTCAAGACCCGGATGG
TGGTAATGGAGATGCTGGCGGTTTTTTCAGTGGTGTCACATGGCTGTTATCAGCACTTGACTCTAACCTTGGTGGATCAGCACCTGTATCAGCCTCACCG
CCGAGATCTCACCTTTCACCTGGATTCGAGCAGTACCAGCTTAGTCCGGCAGAGTTAGCCTCGCACACGGAAGACCTTGTAATCGAGGGGAAGACATCAT
CAAAACAGCATTCTGATGCTGACCATGACCCGAGAGGCGAATTTGGTACTGATCAGTGGATCCGAAACACGTTGCAGCCTTATCGGCTTGAATTTTTGAT
GCAAGATGTGGCAAGCCTCCCGTCACGTGCTCTGGCTGAAGTTATTGAGGCACTGCATGACGAAATCCTGCTCGTGATGCGAGGCCCTGACGAAAAGGAG
TCGCAAAAAGACAGGAAAAGGGCTACCAAGCTGTCGCTCAGCCAAGGAGGTTGTGTGTTGTTTGAGCACTTGTTGAGTCAAGTGGTATCGCTTAGTGGAT
CGCTCTTTGATGGTGGTACCGATGACGAAGACGGAATATCTGCAGTCTTGGAAGCTCACTGCACTCAGATTCTGGAGTTTCTCCGACCGGTACTGCTTAC
CAACTATAGCCCAAGCGGCCTGTCGTACGAAAACGCGTGCTTCCTCCTCCACAAGTCTATCAACGGGTTGTTTGCATGGGTGACACGTACGCGTAATGAT
ACCAACGGGCTACTGCTGGTAAACTTCCTGGGTACTTTAATGGAAATGAGCGGCGACGATGAGCTGATTCGACCATTCCTGACGCCAATTATGTGCGGGT
TGGACCGATACGTGACATTGGTGGAGCCAAGCAATTTGCACTACACGCGCTTGGACTGGCTGACGATTTGCAATTTAATCAGTTGGTCGGTTAAAATGCC
TCATGCAGCCTCACATGCTTTCGGATTGCTTGAGCGGCTCGTAACGGAGAAGATCTGGAACGGAGACGGAAACGAAATTCTCATCAGTGACTGCTACACG
AAAATGATTATGTTCGCCATGAAGACTCGCGACCCGCGCGATTCGTGGGCACCGTCACGCCCGATCGATTTGCTACTCTTCATGTTTGACACACTTCGTC
CCGACACGCCCAACTATGTTGAAGAACGCTTGCGATTCTTGGGCGGGATGGCTGTTGTGTCGAGACACTTGTTGCTAAACCAGATCAAGCAGGAGCTTTC
CAACGACATTGTTGTGACTGCAATTGAAGGATTAAAACACATGCTACGTGAACACACAGGAACTGAGCAGTCATTCAAACCCGGGGCATGGCTGGATGTT
CTTCGATACGGTCTTGTTCCTATCGGTTTTGATTTGCTTAACGATGCCGACCCCAAGCATTTCGGCGGAGCAATGCACTTTGGGGATGACGAAGAGGAAA
CAAACTCACCTTTCCTGTACTACCGGCGACAGTTGCCTTTCGTTGGTGATGAAAGTTCAGTGAAGCACCCGAACGCGTCACACAATGCTGCCAAGGGACC
CACTTGTCGTAGGCGACGACCATCGACTATGAAAGACCCGCTAGCATTACGACCGCATGTGGTGGTGGTCCAATTGTTATCACTTGTCGTGTGTGAAGAG
TTCACAAAGCTGCAGACCTGCGCCAAGTTCCCGCTTGTCTGGGAAGATGTGGCCGAGTTGCTAGTGGGATTGTTGGAATACACTGCGATGGAGAACCCTC
CATCTGCTGGAGATGGAGCAGCGAGTGGGGAGGTTTTGATTGCGGCACTAGAGCGCCGAAGTGTGCTCTCAGCTCACGAGGAGATTCTTGAACACAGCAA
GGGAATTGTGAGACGGCTGGCTGTGCTACAGGACAAAGAGTCCAAAACATCCGAGGAAACAAAAGAGCAAGAAGCCAAAACTGAGGAAGGTTCAGAAACC
GAGCAGCCTAATGCGTTGATGCAGATGCTGAGAGCGAAGTGCCGCTCTAATCCGGACTTGCTTGATCAGCTTTTCTCATCCAAGGACGACACTGGATCGA
CTGGAGGACGCACTCCTCCTATCGAAGAGGTTGACGGAGAAAATGCTGAAGATCAAAACGATAGTGACGATGCGAGTTAAACCGATGCAGGTACTGTCAT
GTGACGGCAATGGATTAATGCTTGTTCATAGAAGTATGCAAATAATGCGATGACTTATAGTTTGCTGTTTGCTGTCTTCGCGTTAGCTGGTGGGTCTAAC
AGCTGCGTGCCCGCTTTCTGAAGTTGGCCCATGTGCATCTAATAGACTCACAGCCTCATCAGCCTTGGAGTAGACGGTCTTAAGTTTTTCGGAGAAACAT
TGCGTGAATGTCTCCGCCAACTTGTTGATGATCACGTCCTTCAAGTTGGCGTCGTTCTGCCCTACTGCGATATCACACAGTCGTTCAGTGATGTCAACAA
GCTGCCTTATCTGTTGTGACAACAATCACGAGTTAGCTTGCGGCACTTGGAGTAATATCGTCTACATACCTGTTCGCTAACGCGCGAAACATTTTCTTCC
AGCCGCTTTGCTCCCGGGTTCTGCTGTCCACTGCCACTTCGTAGTGCCTCCGCCTTGCGAACGATTTCAGCCGTATCGTCTTCAGGACGTTGCTGCTTAC
CTTGAGCTCCTACACCAGCACGTTTCTCCAAAGTCTCGAGAGCTTCCTTGACATGCCCCTGAACTAGAGCAATTTGTTGGATGTTCTCAGTGCAATTCGC
GTTGACATGCGTCGTGATATGATCGAGGCACTTGTGGACATTTTCGAGCTCCACAGCCAATTTCTGCGTCTCAGCCTTCGCTGCCAATCGCTTTTTGTTC
GAGTCTTCAATCTCGCGCTTAGCTGCAGCAAGTTCCTTTGCTCGCTGTTGAACCTTCTCGGACTCTTGGACAGTAGTGAGGGCATGCTTCAACGAGGCGA
CTTCATCTGTGAGACTTTGGATGGTTGATGCACTTTGAGCAGCTTTTTCGCTGGTCTCCTCGCGAAGCTGCTTCACCTGCTGATCATTGTCGACATTGCG
TTGGTTCACCTCCATACGCAGTCGATCGACCTCTTTCTGCAGCGCACTTCTCGACTCTAATAAGGTTGTCTTCTCACTGACCAATGACTGCACGAGAGCT
TTCGCCTTCTGCCGCTTGTCCGTGTTTTCTTTGTTGATAGTCTCAATTGATGTGGTTAGCTCTTGGTTCTTCTTCTCGAGTTGAGTGCACTTCGTTTGCA
GCTCTTTGAGACTTCCCTCTGCTTTTTGGAAGTCAGCGTGGACCGAGTCTGAGCGTTGACGGTGTTCTGTGCTGTCAGATTTGAGCGTGCTGTGTTGTGC
CTGAAGCTCGGCCATTTCGATGCTCCATTTTTTCATCTCGGCCTTCAGCGTGGTCATTTCGACCTCTTTTTCGGAGATTTTCTCGTTAAGTTTCAAGTTC
TGCTGCATCATATCATCAAGACGCTCCTGAGAAGCCAAGTATTGTTGTTTGATGGTTTGCATCTCACCCAGCTGAGACTGTGTTTCCGCGATCAAGCTAT
CGCTACGGCTCCTACCAAGATTGACTTTCTCGTACAGTTGGGTAATCTCAGCAAGCTTTTCTTCCAGATCGGTGCATTTACCACACGAATACGATGCCAG
CTCATCACACTTAGCCTGTAGTTGGCTTTGAAGCGAGGAAATCTCGGCTTGGCTTTGAAGTGCCTTGGATTCGTTGTCATCCGCCCGTCGTCGATAGTTA
TCTAGTTGCTCCAACTGGAAATCCTTATCCGATAGCTGCTTTTGAAGATGCTGGT