Description :
From Genome Similarity Track
Location :
Scaffold_75:24614- 26051
Transcript NameFunction/comments
Albla_Nc14057730conserved hypothetical protein
Albla_Nc14057740conserved hypothetical protein

Sequence
1437 bases(100 bases per row)
TCGCATCGCTCTTTGAGTCCAACTTTATGGTGATCGAGTAAAGGCAAGGATGTAGCGTGGACGTCTTTGTACTGCTCGATTTTCATACGTTTCTGCAGCT
GGTTGGTGCTCAGGGTATCTCGGGCTTGAGGTGAAATGTTCTCTTGCTGCATGCTCATTGATTTCACTTTGAAGGCGACATCGCGCACACATTTCGTCGG
AATGGACGACGCGATGTGAATGTACCTGGTCACATTGTCGTACTTTTCGTCAGGGAAGTCCTCTAATCCGCGAAGGAGCAATTGCAACTCTTCTGCAGAC
CAACGGGTATCTGAAGTTGAATACACAACACCCGGAGAGAATGCAGGTTCACTAACGGAATTGCATGCTTGTTTTGACAGCGTAGTTGCCATTGAAGCCA
TAGCCTTGTCAGGACTTTGTGATGGCATCATCGGGGAGTGAGGTGAATGTTTGGAAACCTCATTCGGCTCGTTGTTACTACGCCTGTGATCATCGTTCAT
CCGCATCATCGCACAAGGGTGGTGCGCCACCTCCTCTTTATGCGACTCTTGCATCTGCGCACTATGACGCAAGTACTGATCCGTCCGATGAAGTTGAACC
TGAACAGACGTGATTGACGCAACGAACACGTATGTGGCGCTCTGTTGTATACGGCGCTGCAACACCACAAAAGTGCAAGATTATATTTCACATACATCTT
TTGCCTCTAATCATTCAATGTGTTAATATCGCGAACCGTAAAGCCTGCTGTAGTCCTTGTTCTATTCTACTGGCGAGACTTCAATGAATTTTTCTTGCAC
CACGGGAATGAGTCTCGTAATTGGCGGAAGCATCTCTAATTGAGCGTGGTGGGTCCTGTCATGCACACGATAGATTTTGAGCCGAGCGAATAAGGGTAGT
GTGTCGGTCCTGCGTCAACTTCCAGATACGTCGCTGTCTGGTGCAATATCTGATTCAGATGGTGAGCCATCCCGAGGCACACATTACAGACTACTTCGAC
TGCACGTGCACTCCGAGAACTCAATGCCACCCCCAATTGCGACTAATAAATCAAGGAACATGTGCATATTGTACACTTGTGTGATGCATTGTACTTGCTG
TATCGGCGAACTGATTTGACTGGATTTTCATTTACTTTTTGGAAGGTAAGAATGGAGCGTGAGGAAGTCCCGAGTGACGAATCTCGATTTTTTGGTAGCT
AGAATCCAAGTCAGGATAGTAGTGGGTGAGTATGAGCACGTACAATTTCGAAGTAGCCCCACTCCATTCGATTTTCCCGCAGAGACTTGCGTTACAAAAA
GATTCCGAAATGAATCGATCTTTTTTGGCACACATGAAATCCCGCCTCCACCAGTACAATTTTTTCCATACATTCCATCACCCCAAGAATATAGCTCGCC
CTTCGCGGATACGGCCACTGAATAGCTGGAACCCGCG