Description :
From Genome Similarity Track
Location :
Scaffold_609:2461- 3999
Transcript NameFunction/comments
Phyke_g10434hypothetical protein

Sequence
1538 bases(100 bases per row)
ACTCTTCTTTCCCGCACCACTTATGTGCGTTTCTGATTTTCCATGCTGCAAATTGAAGCCTGCGATGCGGTCTGGAGGGCAGCGATGCTCAATTGCCATG
GCACCGGGCCCGAGACATACCCAGCACTGCACCAGAACGCTGTGATGCTCCAACTTCAGAAACGCAGGACCTCCGTCTCATTTTATTGAAAAGGATCTTT
CGCGTACGGCATTGTGATGCATTGCAGTATTAATAAATCACGTGACGCGTACAGCTATCACATACTGAATGCAATCTGTATCGCCCGCGGCATGATGTGC
ACTTGAGTCTCTTTTAAGATATACGGTTGTTCTTCAGACAGACTCGGTTCTGTCCCTCCGTATCTCGAGATGGGTTTTGCCTCTTCAATTGACCTCGCTG
ACCTGAAGATGCGCTGCCGCCGTGTCGCCATGAACGAGCGCGCGATCCTGGGATGATTCTTGCTGCTTCCTTATCTACGTGGCCAGGTTCATACAACGAG
CAGTTCGTTGATCCGTCTGTCGTTCAACGTGAGCACCACGACGTGGCCTAAAAGAGACTTGAGCACGCGTTGAAATTGCTCGGTTGCCCCAATTGGAGCT
GGATTGAAGACCAGCTATGTAGCGAGCCGAAGCCGGTTGGTGGCGTACACTACGATTTTCAGTAGTTGAGCATGTAATTCCTCAGCTAAGCATGCACCTT
CACTTGTGTTGCGAAGCAATAGCGTTTTGACTGGGCACACACTTAACGCTATGATATCGATGATAGCTTTAGTTCTCCGCGTGGCGAAAGCAGTGTCTGA
GATGGCATTTAGGTCGACAAGCGTGGGCATTGTGTATCGACAAATGACAAACCGGGTTTGGTTTCACAGATGGGTAGTGCCCTGTGTGCTTTTCGTGTTG
GGAGGCTCGCTTCTTGACGGGCTTTTCGCAAATGTGTTCGATCAAAAGGTTTGAATCGTGCTGGTTACACTCATGGTGTTGCCAGTGTGCCTCGTCCCAA
CACTCAAGGAAGGAGCAGATGCAGGCTGCGCTGGCACCATCATCGCCGATTGCATTGGTGTCCATCCGAGCATATCAGGATACCAGCACCAGAATTTTCC
TTATCACAAATGGCCATTTCCTTCGGGAACCTTTCGCTGGCACATGGTGCAGGCATCGTGATTTCAtcgctccagcgccagcacagcAATTCGGTGTGTA
TACCTCGTGCCGTGGGCATAACCATGGCTTTCATCTCGGTGCTTTTCCTGGGTTTTACCAGCAGTGGATGCTCTGCTATGGGGTGTCAGATCTCCGGCAA
CCTGCTATTCACCATCTATTCAAACGCGGTCTCTGGACTCACTTCGTTAGGCTTCACATCGAGCTGGGGCGCCGTCGCCCTGGTGTATCTCTTTATGCAG
CTGTACATTACTATTGCCTGCATTCTACATCTCCGAGCGACTTGTTCTGGGCATACAAAACgcccagcagcatcaaccaCGATGAGCTGCATTATTTTGC
CGATTGTGTTTTACCTGAAGCGATGGTCCCTAATTGCG