Description :
From Genome Similarity Track
Location :
Scaffold_75:24609- 29636
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
5027 bases(100 bases per row)
TTCGGCATCAAGTGGGAGCAGAATCACGTCGTCGCGATCGAGCTGTCCCGGAACGGATTGCTTGGAGCGCTGCCCGTCGAACTTGTTCATCTGCGCGCGC
TACGAACCCTCAAGCTCCGCGAGAACCCAGGACTTCGTGGTTCTGTGCCTCCGGAATTGTTCTCTGATATGCCGTGTCTGCGTGGCTGCTACTTGGACGG
CACGAGTCTTACCCAAGTGCTGCCGCTCACCAACGTCCACTCGATGGAGATCACGAAAGTCCACGGCTCGGGCACCACGGTAACCGTCAGCTTTTGCACG
GGCGGACCGCGCAGCCTTCACAATCCATCGACCGTCCAGACGCACTGGCTCGCCGATGTGACCGAGGCCGAGATGTTCATGATGCACACGACGCTGGTAG
CGCAGCGACAGACCAAGAACCCGACCACGGCGCGAGTGATCACGCGCACGGCGAGCAATGCGACGGGACCTGAGCGGATCGCGGCCGCCGTCAAACTGCA
GCGCATCTATCGCGCGCGCATGGAGCGCACCAAATTCCGCCACTTTCTGCGCTCGTTGTTCGAGACCAAGATCGACGCTGCCTCGGGTTACCGGTACTAT
GTTGACACGCGCACAGGCGAGGCGACATGGGAGCGACCAGCCTTCATCTCGACGCCGCGTTCACAGAGTGGCGGCCAGTCATCAGCAAGCGGCGAGATCT
TGGAGGCGGGAACCGAGGCATGGCAAGCCTGCGACGACGGCAGCGGCAATACGGTGCGGTTCAAAAGTGTCATAAACAGATTTTGTTGTCTATGGAGACT
GACGCCGTGTTGCAGTACTACTGGAACAGCACAACAGGCGAGTCAACGTGGGAACCGCCGCAACTTCGATCCAGGATCCACGAGGAGCTACGCATGCGGT
ACGGCGCCGACAAGACGGACGAGCAGTGCTTCGAACTCTTCTTCCAAGACATCGACATCGACAACACTGGCGAAATCGACTGCGACGAGTTTGCACGCCT
GTGCGGCGATCTTGGCATGGCCATGTCGTCCTCGCAGATCGCGCACGCATTCCGCCAGCTTGACACGAGCGGCGATGGACAGCTCAGTCGTCCGGAGTTC
ATAGCGTGGCTGACATACAATTTCTAGTCGCACTTGTTGCGAATAATAAAATGATACACGAGTGGATCTTCCGATCATCACTACTCGTCACTCAGCAGCT
CCACCAGCTTCTCCGAGTCGGCGATCGTCCTCGTGAGGCCGATGATCTCGTTGGCACTGATCATGTACGTGTCTGTGCACGCGCACCGAACAGAACGCTT
CGCTCCAGTGCCATGCTCACTGCCGATATCGATCCCGGCTGGCTCGAAGGTTGCATCGAACTCGACAATCACCATGTCACCGTTGGCGTGCATGCGCTTC
TCTTCGACCGAGACCACCTGCACACACCGGTTAAATAGCGAAACGTACTTGGCCACTCCGTGTTCGCCGTGGTATGTGCCCCAAAACGGGATTTCCTCCG
GCACGTCCGACTTGAGGATGAAGTTCGATGCGATCATCGGGCCGAGTAGATTCACGTCGGGAACTGCAGAGTAATGCCGGACCAACCCTTGACGATTCGA
CGCCACACACTCCACCAGGGTGATGTTAGCGGCTTCGTCCGCATCACTGAAGCTGCCTTGGCGAGACGTCCGTGATATAGCGACAGAGTGCATCGTTTCA
AACCATCGCGTCCGGCTGATGTCAGACCCCGTGACAAACGTCAGTGATTCTTGCACCTCGCGATGACCGTCAAACACCTCGACTTGGAACCCGAAGGCTC
CGATTTCTGGATTCTTCACGCTCCGGCCGAACGCGATCCACTTCCACGACTTGATAACCACCAATTTCTTCGGACGATTGTTCCAGTACTGCTTGCTAGA
GAGCAGAAATTGCTTGAGCTTCGTCGCAGACGCTGCCTTGGCGTTCGATTTCGACGATGGCGAGTTCATTCCGCCGTTCATGTTCGCTGAAGGCGACGCG
AGGTCCTGGATGGTGAGCTCGCACGTCTGTTTGTCGAACTTCAGGCTCACATGAACCCACTTGGCACGTTTCTGGTATGCATATCCAGTAATTGAAACAT
CGTCTTCAACTGGGTCAAACGACGTCGTCGAGTCTGCTCGAAGGATATCAATGATGGACTCTGGGTACTGGCTTTTCGCGCGGCTGCGCAACATATCGGT
GGGATGGACCATTTCCTGGCCACTCGCGCGGTTCTGTGCCGACCCAAAGCCTTCTTTCTCCATCGGAAGTCGACGAAACGGGATAAGCTCTCGCGACAGA
TATTCGCTTGCAGAAGACGACGGACGCGCGAACGGGATCATCTCCTCCAAGCCATCGTCGCTGATCCGGCGGATACGGTTGTTGGCGCCACCTTCATCAC
CTGCAGACATGCTGAACAAGGATTCGTCCAGTGCATCCATCTGCTGATAGTGCGACGCCACGATGGTGCCCACAAAATCGGACCAGCCGTCAGTGCTGTT
GCAGTATTGGCGGATGAGCTCTTGTTGGAGCGTGGGAGAGCCGCAGATCTTGTCAATCTTGACGCCTAGAATCGCCAGATGCGGGTCATACGCGTGCTTC
ATTGAGCTCTTGCGCAGCTTGTGCATGATGAAGTTGAGGATCGACTCGGGTGGACGAAACACACTGCGAAGCAGCGGGTTATTCATGCGTCCGTTGGTCG
TCTGGCGGTCAAGCAGGTTGAGGTAGAGCTTGAGCAGTCGACAATGCAATATGTTGGCCTTCGGGAACTTCTCGAAAGTGTCCAGCAGCGACTTCGCCAG
CTCCAGTCGAGTCAATCTCGTGTCGATCGCATCTCTCGACATGCGGATGATGGCATCCAGCAGCTCCACAACATGCATCACAAGCAGCGTTGAGGTCAGC
GGACGATGCTTGATGACTGTTTTGCCGAGTGGGGATCGTATGAGGGCAGGCGATCCCATTCGGAAATCCGCCTCGTCTTGCATCGAGCTAAGGATCTCCG
CACTGACGCGACTGAACGATCCTTCGTCCCGATCTTCAGTCGATGTCGACGAATCCGAGTCTTCTTCGCCCGCAGAGTCGTCCGAATCGCTGTCGCTGAA
ACAGGCGCGCGCGGCAAACTCGGAAATAGTGGAGAGATGTTGGTGGTAGTTGATCGACGCGCAGATGCTCTCGAGGATCGTCTGCACCGGAGCAACGAGC
TGGTCCAACCGTTGCGGGTTGTCGAGAGAGCACTCGATCACCAGCCGCAGCGTGTCAATCACCAATGTCGTCGGCACACCTTCGCCGTTGGCTTGATTGG
CCTCCAGATAGCGAAGTTCCATTGTGCCCAGCTCCGCCAGTCGCATGATCACATCGGGGTTCTCCAGCAGTGCACCAAGCACGACGTTTTTCAGATCATT
GTGGATCTTCGGGTCGTTCGGCAACATTTTTGGCGGAAACAACTCTCTCTCAAATGGCTCAACGCTCTCAAACGACGAGAGTTGGATTCTGCTCTGGATA
TAGTACTGGAACGTGTTCGGGAATTCTTGTGCGAGGATCTTTGAGAGAATCCCAACGCACCCAGTGATCCGGTCGTGTGCGATTGGACGCCGCGAGCTGA
AGACGGCAGTCGATGTCGAGAAGTTCAGGCCAGGCGATGCGAGAGACGAAGTTGCCGACGTAGGCGAGAGCGAGGAAGTGGACGATGAAGTCGACGTGGA
CGAAGCTGACGAGAGAGTTCGCACAGGGCGTGTCGGCATTCCGTCCACGGCACGCCGAACAATACAGCGAATCGCTCGATCAAACGAGACATCTCGGCGC
TGGGCGAGGTGGATCAGGCCGTGCAGGAGCGACGCAACCTCCGGATTATATGCGTGGTACGCCAATCGCTCCAGCACCGTCTCCTTTCTTCGCGAGCCTT
CGCTCTGCCCTTCGATTTCACAGATCATTCGATGCACCGCCGGGAATATAACCAGATTCTTGGTGATACGGCACAGGTATGCGGCCAAGACGCTGTCCAT
GGCGGTATCGCTGTCGTCCACAGACTTCTTCAGTCCGTTCAAAGGCCCACTGCTTTTGCCGGAAGACTCGTCACTGAGCTTGAAGCTCCTGGTGGCTGCG
TCGCTCCACAAACATCGGAATAGCCCGCCAAAGATCCGCTTCCACTGCGTCACGGACAACTCGTCAAGGCGCAGGATGAACCCGCGAACGACAGGGTTGG
CGTTGAGCTCTGACCCGCTGTCCGTCTCGTCATAGTCTGAAAAGCTGCTGCTCATGCTCTCCAGCCGCATGCTCACATGAAGCCGGAAGTTCTTGCGGTT
CGCCGACCCATGCCTCTGGAACTTGCCGGTGAAACTCAACGACGGAGCGAGCGGCTGGGCTGAACGCGACGGCGGAATGGATAACACCTTGGCGTCATCC
AACGTGAACGTCGGCTTCAACGACTGCGTCTCGTCCATGCTCGTGTCTGCCTCATACTCTTCCTCCACCTCGTCATGCTCCACGCCTTTCTCGTCTTGAA
CGTCCGGCGCATTATTTGATTCTGGCTGTTCGTCAGACCTCGGCTCGCCGTGCCACGCCATCGCCTTCAGGTAGAATTTCAAGATGATCTCGGTCGCGAG
GAACGCGCGGTGGTACCGATCGCGCAGGTCCTGGTGTCCGCGCCGGCTCTCCGGCACAGACGTGGCGTACTCGAACACCTTGGTGATCGACTCGGGCTCG
AGCAGCAGCCGCTGAATGGGCGAGTAGCCGCGCTCGCGGCGCTGCACGGTCGACAGCACGGTCTCCATGTCGTAGCACGCGCAGAAGACGTTGGGCAGCG
ACTGCGCGAGACGCAGCGCCTCCGAGTTGTGCAGTGCCTGCGACGTCTTGATCGGGTCGCGCACGCCCGACGTGGACCGCGTGAGGTCGAGCAGCGAGAG
CGACTTGGCCCACGCGGCCGCCTTGGTGCCGACGAGATCGCCACCTTGCGCGTCGCCATCCAGCAGCTCCTGCTCGCTCTCGGCCTCCGAGTCCGACTCG
GTCTCGACCACGCACGTGCACTTCCGC