Description :
From Genome Similarity Track
Location :
Scaffold_191:24602- 32018
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_191-fgenesh-gene-0.2Titin isoform N2-B
Pytir_DAOMBR486maker-pir_contig_191-snap-gene-0.16Abnormal spindle-like microcephaly-associated protein homolog

Sequence
7416 bases(100 bases per row)
TGACGCAGTGGATGTGAACAGCTCTCCGTTTTTAGTTAGCGTCGTGCCGAATGGCCCCATCGGCACGACCAGCACTGCCTCAGGCTCGGGTTTAACCTCT
GCAGCTACAAACGTCCAGGCGTCATTCCAGGTCACAGCCCGAGATCTCAACAGCAATCTGGTGAAGCAAGGCGGCGCCACTTTCCAAGTGATCGTTGAGC
TCTCTGGGAAGGTGAACGTGACTGGTTCATGCGGCGATTTGCTCACTGGCACCTATTCGTGCACATACACGGCGAAGTACGTAGGCAGCTCCAGATTGCA
CGTTATTCTAACCTCCAGTGGTGGCGGATCGCTGCCGGTTTCAGGGAGTCCGTTTGCTTTAAACGTGGTCGCAGGACCAGCACTGGGCTCGCTCAGTCTC
GCGCAGGGGGCGGGGCTCGTGTCGTCTATTGCTGGGGTGCGTGCGAACTTCACTGTGTTCGTGCGAGACGCTTTCAGTAACGAGAAGCGGAATGCCGGAC
AGGAGACTGTGACGGTCGTGTTCAAAGGACCCGCACCAGCGACGACGACCATCGCCGTCCCATCTGGCCTTACAGTGTCGTTCCTGGGCGACGACAAGTT
CTTTGTAAGCTATGCGCTGCAGGCCAAAGGGAAGTACGCCATCCAAGTCCAGCTCAACAGCGTGGACGTGCTCGGCAGCCCGTTTACAATGTACACGTAC
CCAGCAGAGGCCTCGCCTGTCACTACGTCGTTAGATTTGATTACCCCACTGGGGACGACAATTTCCCCCTTGGTGTATACCGCAGGCGCGTTGATCACCA
CTCGTTTGACGACGAGAGATACTTTTGGGAACGTGCTGGAAAGCGGAGGGCACGCGTTCCAATGGGACGACGAGGTCCAAGCCTTCCAGGAGAAACCAGT
GTTCGATGAAGTGAACGGGAGCTATTCGCTCTGGCTCAAGCCCTTGAAGACCGGAGTTTTCCCATTCCAACCAAGGATCTTGCTCAAAGGCGGGCTGAAT
GCGAGCTATTACCCGAATCCCGACTTCGTGAGTCCGTCGGTGCTCAAGAAACAAGATGCCCAAATCGATTTCGACTTTAAAGTGAGTCCACCGGCTTGGA
CAGACACGATGGAGACCTTCAGCGTGCGCTGGAACGGCTTTTTGCTGCCGGCATACAGCGAGATGTACACTTTTGAGACCGAGGTGCTCGGCAGCGTGAG
TCTCTCGGTGGACGGCGTGTCGCTGCTGCTCGCTAATCTGCGCCCCGATGCGAATCACACACAGTCCAAGCAGCAAGCCCCCCATGTGTACCTGGTTGCG
AACCAGTTTGTATCGATTGAGCTGAATTACACCAAGCCAAAGCAGTTCTCGAATGGCAAAATGCGTCTCTTTTGGCAGAGTCTGTCCCAACAACGTGAAG
TTATCCCTTCGAGTCGCTACTTCACGTCCTGGCGCATTGTGAACAACGTCCCGAGTCTCAACATCCTACCCGCGAGTGCGAATCCGCCGTCGTTCACCGC
CGATTTCCCGTCCAGTTCGATAGTGAAACTCAGCGAGACTCAGGCAACAAGATCCTCTTCACTGCCGATAATCCGAGCAACTGCAGGGGATAAGTTTGTC
TTCCGTGTCATCGCGAGAGATCAGTTCGGCAACAGAAGATTCGTGGGCGGCGACATTTTTCACGTCCTATTTCCTCAGTTGCCTGTGGACGTGACGCCTT
TCCCACTCAACATTGTTGATTTCAACAACGCGACGTATGAGATCTCATTCTCTCCGATATTGAGCGGCACGTTTTCCATGGTCATCGCGGCGACGGATCC
AAGTCTCACAGGGCATCAAGCGCTTGACGGAAACGCGCTGGCGCTGTTCCTCCGTCCGTATTATATTCGGCAGAGTCCGTTCACGCTCATTGTCGAGCCG
AATGCACCGCTAGCGACAATGTCGACGACCTCAGGGATCGGATTCTTCCAGGCGACGGCAGGCAAAGAAGCATCGTTCAACATCCAGCTTCGTGATCTGC
ACTCCAACCCGATCGATGGCAGAGGTGGTCTCATTCAAGCACTGCCTCGAGTGCAACTTCGTCTTGGAGGCACAGCCCCAACTGATCCGGTTGTTGCCAC
TGTTGATGCCACAGCGTCGAGGTCTCAAGATGGTACCTTTGAGGCAACGTACACTGTGACTCGGGCAGGTCTCTACCAAGTACTCCTCAGCGTCGATGGT
GGAGCCACCTTTGCCTCCAAGAGCTCGACGCTGCGGGTGTATCCAAGCATTGCATCAGCGCTGACCTCGATGATCACTGGAGGCACGGGACTCGGGCCTC
AGATTCCAGTCAACCAACTGCAGACCTACAAAGTCACCCTGAGGGATTTCTACAGCAACTCAAAGGGCATCGGCAACGATAACCTCGTGGTGGTGCTCAG
AGGGCCCAAAATCGTGTACCCACAAACCATCACAGACCTCTCCACCGGCGAGTACGTCGTCGCGTACATGGCGAACCAGCCGGGGGTGTACGAGATCCAG
ACGTTGGTGGCCAACCACGGCCAGGGGCTCATCGGGAGCTACTTTGAGTCCACGCGGTTCGTCGGCAGCTCCGCCACCGCAGCTCAAGTGGTGGATGAAA
AGATCGATTTTGACTGGAAGACCAACGAGACGATGCGCAGCTATCCTCGCGTCCAGTGGAGAGGGTTTTTGAAACCAAAGTACTCGGAGGTGTATACGCT
CTACTTGAAAGTGTATCCCTACGGTGTAGTGTACATCGACCAGATCCCAGTGGTCGATGCGCTGAACACTCCGTTGGCTGAAGGGACGACTGAGATCAGT
GGAGACGTGAGCTTGTACGCTGGCAGACTCCATGCTATCACGGTTGAGTACCGAAGTCCCTCGGCACGAGAGGTCTTTGGATTTGTATCGTTGGAGTGGG
AGAGCGACCGCCAGAACCGGGAGGTTGTACCATCGATTGCGCTAATCCCCGGCGCGCAGGAGATTCATCCGAGGTACACGGTCGTCGCGGTAGATTGACT
GATAGATTAATTGCTCGGGTTTGCTGAGAGGCGAAGAGTCGCAACACATTTCGAGCGACTATCAATGGGAAACCGCTTGGCTGGTTGGTCTATTTATTTG
AGGCGGTGTCAGCAGCAAACGGTCTAGTGAGTTGTATCGGGACCTTTTGGGATCCTTTTGCGACGCTACTTCCCCACTTACACAAGAAGAGGGTGATAAT
GGTGCAAAGCAAAGCGCACTCTGTAAACGCGTAGAAGTACCAGGGTATCCTTCCCCGAACAGTGATGCACACCACTGCTGTAACGGCGTGCTCGACCACA
CGAGAGCCTCGTAGTGAGGCTACGGCGAAAACCCAGAATGAGCAGAACGAGTTCCTACAACTGGCAGCAGACCTGGGCGGCTGCATGGCGTTCGAGCCAA
AGAAATGGCGACAGGTGCTGGAGAAATCAACCTCCGTTCTTCACAACAGCAGCAGCACGCAGCGAAAACAACGGGAGAGTAACGCACTCCATGAGCCTAC
TACGAAAGACCATAAGGCAATGGTGAGGAAGAGATCCCGAGTGCAGCAACATGTAGCGATCAATAGCAGCAACTCTCGTCCTTCCTCGCGTGATGAAGAT
GTCCCCACTGCGGCGGTCTTGCCCAGCGTCTACCCTCTTATAGGTCTATCGAATCGCGTAAAGTTCCAGACGGCTACGTTGTCGCTCTCTGAGTACCTCA
ACCAACCGGCGATGGTGCACGCCATTTTGGAGGAAGCAGCTGTAGAGATCGACCTTGAACATGGTGATGAAGAAGACTCTGTGCAGCCATCAGAGCTGAC
GATGCGAAATGACGCCGCGAATTTGCATGGAAATAATCTTGAGCCTGATACCTGGACCCCGACTTCCCAGCAGCAGCAGCAGTTCAGCGCTAGATCGCAA
GTCTCTTCCAACAACAACACTACTATCATACTCCCGCTACTGACGACCATGTCTCCGAGAACGCGTCAGAAACTCGCGCGCCTGCCGCCGCCAACGGACG
ACGACCTACAGGAAATCCAGGAAATGGAGGACTTTATTGGGAGCAAGAACCTCTCTCACGGCTTCTACCAGATGCTCAAGCGACAGCAGATCCAGCGACA
CGAGAGGACGGATAAAAAGCAGCGAAGACTTACTGTTCTAGTCCAGCAACGAACAGGATCGCTAGCTAAACTCAACAGCACTGTACTCGAATCCAACAAT
CAGCGACTACCAGGACAGCAGCGGAAGATCTCGCTCAAGGCGAAATCACCAGTTAAAAACACCATTCGTGACGAGCAGATCCACATGACGATGGAGGATT
TCAATGTCAACAATGTGGAGATCCCAGTCCACACTCTGAACGAAGCCAAGAGTGACACTCGCTCCTATAACAAGCACTATCAGCACCTTTTCCGCCGACA
AGAGAGCGCGATAGCTCACGAACAGGTCGCGCAGAGCCACGTGGTGCACGCGATCACGGAGATTCGCCAATTTCTACCTCTGGAGGCTATTTACGCCTTT
GGGAAGGGCAAATTCGCGTCCTCCGCTCAGCAGCGCGCCGCCGAAGTGTTGTTTCGCGTCGGCACGCGTCTGAAATTCAGTCTGGCCATCCAGGCGATGC
AGCAGTGGCATACAGTGGTCGCTAACCTAAAATTTCAGGAAATGACGACTGCAGCGCTGCAGTTGCAGTGCTGGTGGCGACAGATCTTGGCAGTGAGAGA
GCTGGAGACGCGGCGACGGATTAAAAACGAGCTCCGCAGACAGCAGCTCGCGCTGCTTCGTATGCTCGCAAGCAAGCAGAACAAGAGCGCGAGTGTCATC
ACCATTGCGGTTCAAAACTATGCATATCGTAGAAAGCGGCATCGCCTCATGATACAAACTGACGCGGCCAGGAAGATTCAGGCATTCTGGTGCGAGCGCC
AAGCGTTCTGGGTCGCACTGCGCATCCAACTGCGCAAGAAACAGCGAACTGACGCGGCGATCCGCATCCAAACGCAGGTTCGCGGCTTCCAAGCACGGTG
TAAAAGGCGGTTGCTGCTAAAGATCCGTCGTGTGGAGTTGAAAATGGGTCAGGTGGAGATTGTGAAGAGAGAACTGAAGCGGAATCTGAAAATTCAAGGT
GCGGTCATCACAATTCAACGGGCTTTTAGGGAATGGCAGCAGAAACGCATTCTGAGCTTACGACGGCGACGCGCACAGTTTAAGAGGGACAAAGTCAAGA
TCCTCAAGGTGCAGGCGCAGTATCGCGGTCGCCAAGCCCGCAAGTTTTACATTCGGCACCTGTTCCAGGTCCACAATGCTGTGCTGACGATCCAACGGGC
GTGGCGATGCTCTCAGGCTCGTAAGGTGCGTTCCCAGCTGCGTAGATTGAGAGATGAACAGCGTCGCAGGTGGATTGAGGAGATTGAAGAGCGCCGTCGC
AAGCACAAGAACAAAGGCGCTGTGGTGGTCCATCAGCAGGTCAAGAAGACCTGGAACCAGCTCGTGACCATCAAGGACAAAGTTGTACTCGGTCAGCATA
ACAGCGGTAGTGGTCATGAAGGTCCTAGTCCCCAGGAAGTGCATACTGCGATGAAGCTCCAGGCGCACTGGCGAGGTATCAAGCTCCGCCAGCGGCTTCG
GCAAGAAAAAGCCAGGGACCTTGAGCTCCAGCGGCGTGCTATCAACAGAAAGCGGAAACACGCTGCGATCTGTATCCAGAGGAGAGTTCGAGGCATCCAG
GGCCGAGCACAAGCCTGGAACTTGATGGTGCACAGGAGTGCTGCGCGTATCCAGAGTCTCTGGCGAGGTTTTTGGATGCGCCGTGAGCTTGTGCGCATGC
GAAAGGCGCTGCAAGCGATCCAAAAGATGCAGCTTCAGTGGCGCCAGCGGCGCAGCCTCGAGTACCAGCGCCAGCGCGCACGCGCTGCTACAAAGATCCA
AAAGTGCGCGCGGGTGCTTCTGGGCAGGCGCTGGCTGCGGAGGACGGTGGGTAGACAACAGTTCCTTTCGGAGGAGCAGGCGATGGGCAAAGTGCTGATG
GAGGCCACGCGCAAGCGCGTCAAGGACGAGTTGCTGCTCCAGAGCTTTGTCAACAAAGAGCTCACTACTCCAGCTGCTATCGAGTCCAAGCGAGACCACC
ATGGCCCTAACGATGACGAGGATGACGGCTCCAAGCGTGTGGACAGGTCACTCTTCCGCTTCGATCGCGCCAAAGCGCAAGGCTGGGGGCGCAGGGGCTA
CGACGGTATCTGGCAGGAAGTGTTCCGCAACGCGTCCGGAGGCTCTCCGGAGATCGACAATTCCAGGTTCGCGCGCTTTCTCAAGGCGCTGCCGCGCTCG
TTTGTGAACAAGACGAGCTTCCCGACACAGACGATCGACCTGATCTTCACGAAAATGAAGGAACCGAAAGCAAGATCGATCTCGTTCGCACGGTTCAACA
AGGCAATGGCCATGGTCTGGCAGGAGAAATTCACCCCCAGTAGTAGTGATAAACAAACCAAGCAGCACGACCCCAAGGGGAACTATCACCCCACCACCAC
CATCACCACCAACCTCGTTGAAGCCGCAGCGTTGGACCAAACACGGTACCTCAAGTTCATGAACCAATTTCTACTGCCGTCCACGCTTCAAAACGGCAAG
TACCGAAAACTGTTGGACGACCAGTGCTCGCAGCGCATTCTTTGGGGCGTCGCCATCCTGCGCAGGTTCGCGAGCCGCATCGCAACGCGCAAACTCCACG
ACCATTTCCTCATAATCCATAGAGAGCGACAGGAGCGTAAGCGCCAGGTGCAATGTGCGAACAGCATCCAGATCTGCTACCGGCGCTACAAGTTCCGCGT
TCAGATAAAGAGCGCGCTCGCCAACATGTTTGTCGAGTACGTCGATCATCGTGGTCGCGCGGTCAGGTTAAAGCACATCATGACTGGGAAAATTGTGACC
AGGCGCCCGATTTTCCTCAAGGGCGTCGCTTGCAACAAGGTGATATCGCTGCCGTTCCCAGGCGAAGAGTTCCACGCGTTCTGTGAGCGTCATGAGGACA
GCAGCAGGATAGGAACTAATGTACCAGCCGAGGTGTATTGCGTCGAGTGCGAGGACGCCATGTGCGAGATCTGCTTTGCTCGCGATCACAACAAGCGCCA
GGAGTTCCAGAGTCACGAGAAGCGCCGGATCCCAGTGTGCAGCCACTGCCAGGTCGAGACCGCGACAAGGGAGTGTCTCCACTGCGGGAACGGCCACGTG
CCGTTCTGCGACGCTTGCTTCCCGCATGTTCACAAGCCCGAAGATCCAAACAAGAGGAGAAGCAGCAGCGTCAAGGTACTTGATACAACACCAACACTGT
CGTCGGTGGCGGTACCACTGCATTCGAAGTCGCTGGCCACCCACCGGTTCCAGCCGCTCGTGATGATGTGCATTGAATGCTCTTTACGCGTCGCCCAGTG
GGAGTGCGGGACTTGC