Description :
From Genome Similarity Track
Location :
Scaffold_2839:246- 2745
Sequence
2499 bases(100 bases per row)
TCTATGACGGGGAGCTTTGCTGACAACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAA
GCGTGTTCAACGCCTTCCTCTTCGGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTA
AGGTCTGGGCGACCGCGTGTGGCACTGTGTTATCCACACAGGAAGCGTATCCGACGTCTTCCGCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCT
GTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCG
GCGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGC
CCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGAACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCA
GTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCT
TCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCGCA
AAGCTTCGGACAACTTCTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGGTGATCGTA
CCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCA
CCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCA
GCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTTCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGG
ATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCG
GCGTACGCGCCTGGCGATGGCTGTATTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGTTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGG
GCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATAC
TCGTGCAGTTCGCGTCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACA
GCTGAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACG
CAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCACATGGCTTTACC
TTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGA
ATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGACACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAA
CTGAGAGTCGTTCAAATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGC
TACCAAGTGTGACGGGGTCACACAGCACCTTGCGCAAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTT
TTATTAAAGAGAGCGAAGTGACCCAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAAATTAAGTTTGGGTTTAATACAAACTGTTAGTTACTTA
TGGAAATGCAATGTCATTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCTCGGAGTATGACGTGTCATACTCCTGAAGTGTGA
AGTGTCACACTTCATGTAACCAGGGTACACTTAGGGCTACGTACCCCGTTACAAAACCGCACTGTCAAATAATAAAAACTGACTGAGTTATGGGCACTC