Description :
From Genome Similarity Track
Location :
Scaffold_2315:246- 2505
Sequence
2259 bases(100 bases per row)
CTGCATCTCCCTGAACCACGCCCATGATGCCTCGACTCGCAGTCGACCCGCGACCCTCGGGTCACGCAGCGGTGGGTCATCGCGCCAGATTCATACCACT
CAGTGGATTACGCGCCACTCCCGCGCTCGCCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGCGGATAACGTGCCGCACCACG
TACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTTGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGC
TTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACTAGAAGCAGGGTGCGACGCACCCGGCGTTTTCGACTTCCAGCCGATCCATGGCT
CATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAGCAGCGTTCCACGATATCGAAGTTCTCAAACTTCAC
TCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATAC
AGCTGACTCCCTTCCAGGGTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTT
GAACGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTTAGAGAGATCAGCTCTCTTCGGGGATGAGCCCCGTTGCCCTCTACCTCTTCGAGGCACAAC
AGAACTCAGTTCTTCCCCAGTAGACCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCCGGCGATGACCTGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCT
TGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCTGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTC
ATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCA
TTCAATGCCACATCCACCGCCTCTTCAAAGAGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGATCACGGTCAC
GCTGACAGTTCGGAAGAGGTCCGCGCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCCAATAAATCATTCTTACCCTGGCGGGTAGCAAAGG
AACTTTGACCGGATACGGTACGCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAGTGGGAAATGCAGCGTCAACAGACGTG
CCGCACGTTAGTGCCCATTCGCGAGCGCGACTCCAGCCTGGAGACAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGCGATCCCATGACCATCTC
GACTCACGGTCCGAAAGGAGATTTCTCCATCCTTCCCTGCGAGGTTTTTAGCCTCCCACCGGAGAGCGTTTCACTTTTTTCTGGGAATTTTTTTAGAGCA
CTCTCATTAAAACCCCCCCCCCCCTTGGGGCCGCTCTCTTCGTTTCGGCGCTCATCTTCTATTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAA
CGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTATTAAGCGCGTCCTGC
TGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGGGATTGACTACAAGTGCTACCAAGTGC
AGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCA
GGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGGGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTA
ACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGATAACTTGTTAACTCTCCAACTTATGTACTGAGAGTT
TGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGCTCCACACCATGTAACCCCGTTACA