Description :
From Genome Similarity Track
Location :
Scaffold_3472:246- 1932
Sequence
1686 bases(100 bases per row)
AGTGAGACAGACCTACGGTAATCTTCAGGGTCAGAGTCCGAACGTCGGATTCTGATTCAGTTCTGAGTCGGGCGCCGTGACTGGTGGACAGTCGAGCTGG
GGCGCGTAGCGTCGAGCCTTTTGGCGATAACTGGCCGATTCGGACCGCCGCCTTTTTTCGGGGCGGTGTTTCGCGGAATTCCACCCGCCGACAGCATTTC
TTAAAATTTGGTTTGGCTTGCGAGATTGCTTAAACAGGTTTCAAGCTTTTCGGCCCAATTCCACCTCCACCCCGCCTTCTGAGGGAAATGATCCACGGTT
TCCCGGCATTACTTGGATCCCACCTTCTTAGATTTTTCAATCTGACGGGGAAGGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCA
TCCTATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCC
TGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTTGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCAT
GAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAGCTCTTTCAGATCCGATATTGGCTGAGAATCCCTT
AACCCTCTGGGATCATGGACGATCCACCTGCCCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAG
TTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCGCTCTCATACATTGTTCGGCCAGGA
AACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGAAAGTGTTGGAAGAGCCTGTGGCCGTCTGGTTCACTGGCGAGACCGGATCCGTGAG
GCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGATTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACT
GGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCAGAGGGTCCTAAAGTCATGCGTCGTG
GTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGA
CCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATTCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACGCA
CCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTTGTTGGTGCTCTTACCGGTTCCCTTGGAT
CGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCTTGTCCGAC
CCAGCTTGACTGGGTTCCCAGCTTGGTCTTCTTCCCGACTCTGGAGCTTGCATCCTCCTTCCCGCGTAGTCTTACTCGTGTTCGTC