Description :
From Genome Similarity Track
Location :
Scaffold_17:245990- 254105
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09098sporangia induced dynein heavy chain

Sequence
8115 bases(100 bases per row)
CGCCGAGAAGACGTAGGTGGGTCCACGGAATTCAGTTTTGTAGCACGGGCACACGTACGATCCTTTGACGTCAAGCTTATCGGCTGCTACAGCCTTGCAG
TTAATAACAGGCATAGGTGAAAACATTTCTTTGGGGTGTGAGCGATCCACCGTGTTATTCTGGATATCCCAACGTGCTCCCATGAGGTAGAGACCGTGGA
TATAAGCGCCATCACGAGACGGCGCGTCCACTTCGCCATTGCGGCGCTTAAGAACATCCGTCTGAATCACGAGTTTGTCCAGTTCCCACTGATTCTTCTG
AGCTGTGACCTGCATGATGGCAGTCAGGAACGACTGCGGGTTGATCATACCCGACAGCCACGTGACACGAGGGATATCCGCTGGGTTCTGAGTCCATTCC
TCGAGTTGTTGTAGTCGAGCTTCGAGGTTTGTGAGCCACGAGCCAAGCGGACGCATGGACGGGAAAGCGAGTTTCTCCCACGACTTGGGCACTCGATCCA
GGAACAAAGACTCCTGTACAGCCTCCATAGCGTCCGACATGGTCAGTTCACCCGCAAAGCCCAGCGACAACTCGTTCAGTGATCGCACCACCTCAGCAAG
CAGTCCGTTCATGGCTTCACATTCTTGTATGAAGACGTTCTGGTACGGCCCCATCTCTTCCAAGTTACGCGCAATCTCATCCGTCTCGAACTTCTTCTCA
CCGACGCGAGACAAGACCATCTCCAGACCTTGTTTCGCCAACTCCAACGGACTCATCGCCGCGTCTCCAGCTGCAGCATCTCGAGGCTGCAACTCCATTA
AAGTACGGAATAAATTCTCGGACTGCGTCGTACGGAAATCGATCTCAGCGTTCGGATGTAGGCCAAAGGCCAGGGGTGAGTCTGTCTTGAGCTCCGTCTC
AATATGCTCCAAGTACTTGTCGTACGATGACGGAGCGAGACACATGAAGGACGGACCTTTCTCGTCTCCTACAAACGGGAACATTTCCATCTCGTCCAGT
AATTCATCGCGCATGTAGAAGTCCAGGTACGTGTTAGCCAGCAGTCGATCGAAGTCGTTGACGATGTGTCCACCGTACATGATCTCACCGAAGATATAGC
GCAGATCGGCCCATGGAATCTTACCGCCTGCCGAGCTCTCGAGATAATTCTGCAAACAGATCGCCGAGTCTCGTAGATCACCGAGCGAGAATGGATACAT
CATGTTGAATCCCAGAGGCCCGTACATCTTGCGTTCCATTAGCACAGCGTGAAAGTGGCAGAGTCCAAAGAGAATGGACTTGACCTTACCTTCTGCTTCC
TCGATGTATTCCTTGGGGAAACTCACAAACGCTCGCTTCAAGTTTGCCTTGAGTCCAGACGGAGGCTCATTCGTCAGTTTAATACAGCGGTTGAGTACTC
CAATGGGGATCGAGTTAGACGGGTCGGAAGTCAGGAACAAGCGGAAGTTCTTGTGTGAACCTTCCAATGCGAACTCATCCAGTTTCTTCTCCAGTGCCAA
CAACCAACGAGGCATCAAGTGGATGTTGTTGAGGATGACCCAATGGCCATTACGGTGTGCAACCTCCAGTCGGTCCATGGCGTAGACGTCTTGGCCTTGT
CCCATCGACACATTATGGTAACTCACACCTCGTTCGAAGCCGTACTTGACGCTGAGCTTGTCGACACCAGCCACCACATCGGCACCTGGAGACAAGATGA
AGTACAATGGCGTCGTAGGTGTCGAGTCCAAGTACGAGTTATCCATCACCTGCAACGCGTTGAGAGCCGAGTCGCAGTCGCAGTAGTTGCTTCCGTTGGG
TAGAACTTGACGCACAAACTCGTTCACTGCCACCGTCATACGATCCGGACGCAGACAACGCACCACCAGAAGCTTGAGGAACGGCGTACGATCCAGCCCA
GCCCAGTCCAGAGGAAGCTTCTCGGACTCTGGAGTCACGTGGTTGTACCATTCACGGAAGCGCGACGACGCCTCCTTGAGATCTTGCGGCATCTTCTGGA
ACTCCTCGAGCTGCGCCAACATGTTGATCGCTGTCCATTGAGCTGGAGGCAGCCAGTCAATGGGGTTCGCTTCTTCTTCGCCTCCACCACCTGCTGCTTT
TTTGGGTCCTCGCAGTAGGAACTGCATGTAGGCTTCTTGCACTCGCACGTCCTCGCCCAGAATGCCACGACGCATGAGGTTAAATGTGAGTTGAGAGAGG
AAAATGAGCTTGTGCGCCTCAAAGAGGCCCCGCGAGACCCACGTGAAGATGGTGATTCGCAACGACTCGCGTAAATTCAGTACTCTGTCGCTCTGCTTGT
CGCTCTGTGGCGCTCGATCGATGGAGTTGTAGAAGAACGTGATGAATGAGTCCAGACTGTAGCGATACATGTGGTCAATAGCGCTGAGTGTCGTAAGCAA
GAAGTACAGCATTGCTCCTTCTGCTGCTACAGGACGATAGAGTTCTCGCGTGTTGTTGATGACGATCTCCGTCTCCTGGTTCTTCTTGACTGAGATGGAG
ATATCCGTCGCCTTCTTCTTCGTCTCCTCCAGACTCTCGATCAGAGGCACGTCACTCAGAATATCGTCGGGTGCGTTGGCTAGGCGCTCCAACAGCTGAT
CTTCCAGCTCCACCAGGTCGATCTTGAACTTCTGGAAGGCCAGTACGAGTTCCTGTTTCTGCGCTTCGAGTTCTGGCTGCTCCTTCTTGACCACCTTCTC
CAATAACTGATCTTCTAGACCGCTCTCAGTGGCGATAAAGTTGATCAACGTACACTGTGCAGCAATCTCTGGCTTGTAGTGAGGATTCGACAGTTTGGTC
TGGAGATACATGAAGAAATTCGGGTCATATTGCACTTCTTCACCGGCTAACTTCAAGAAGAGATTGGATCCTTTCTTGTACACTGCACGTCCAAGCACTG
GGTCAAGTGTGGCGTCGATCTCTTCTCCGATGTTCTCGATGATCAGCACGTGGCCATTGACGATCGCAGTTTCAGTCTTCCGTAGCCATTGATTCTGACT
CAGCTGCAAGACAACAAGACCTCGATCTTTCTCCTTCTCACGAAGCCACTTGATGCCTTGCAACTGCGGGTCAATCACCAGTGGCCAACGTTTGCAGCTC
GTAATGATTGCACCATTCTCAATGGAAATCCGATCGGCTGGAAGACCTTCACTCATCATCTTGGCGTTCTTCCCTTCCGTCGTCAGCATGGACAAGGGAT
CAATACCCTCAGTGATGGGGATTCCTTTGGCTACCAGGTCAGGGAACCACGTCTGTTGCCACAATTCTTTACGCACAGCTTGGTCGAATGCGCCTATATA
AGACACAAAGGCAGCAGCTAAGAGGGAGTTGCCCACAACCATCACTCCGGAGTTTTTGAGTTGCTCGATCTCGATGCCCCAACGTTCATTCTCGCTCGCC
AGTCCGTTCACCAGTTTCCCAGCCAATAAAAGTCTGTTCTCGCACGATTCTTTCATCTCCTCCACCTTGAGTTTCTCCTCTGTAGCCTGACATAGCGTAT
TCTCCAGAGCTTCCAGTCGCTTCTGCACTTCAGCTACTTGACCCATGGCACGAGCCAATTGCTCTTCAGCCTCTTCTTTCTTCTTCTTGGAAGCTTCAAG
CGAGTCCATCAGAGGCTTCACACGCACGTAAATGCGGTTAAACGTGTAGATATTGACCACCCACGAGCAGATATTCGCAGCAGCCGAACTCTTGGACGCC
ATCTTCTCGGCTGTGAACTCTGGATCGGCGATCAACGGCTCGATACGCGCGATATCCGCTTCCGGGATGTCTTCGCCCTTGAAATCTTTGAGCGCATCCA
GGAACGCTCCTGCGTTGTTCATCATCTTCTTGGCGCGATCCCATTTGTGGTTCTTGTACTCTTTCTCCACCAAGATCAGACACGCCTTGGTGACATTATC
CACTCCTGCTGGAGGCTTGGGCAGACTCTTAAGCTCTGTGATGGCAGGTTTGGACAGACAATCCACAGCGGCAGCGGCGGCATCCATGGCAGGTTTGGCT
TGACTCAGCTCCTTCTCTGCCTCAGCTGCAAGCTCTGCGGCTGCTGCACTGGCCGCTTCTGCCTTGAGCTTCTCCTTGTTGGCGTTCTCCTGCTGCACTT
CCGCTCCCGCTTTCTCTCGTCCCATTTGCTCCAGTAATTGATCCGTTGAGGCCTGTTTCTCGGCCACTTTGACCATCGTGTGCTTCAGATCCACTTGCAG
TTCCGCCACATCCGCCGAGGTCTTACGCAGAGTCGAGAGTCCGTCATCCAGACGAGAGATCTGACGTTGAATATCCTCCTTCCGCTGCTTGAGCAGGATC
TCGTAGAAGCTGATAAGCTCCAGGAAGCTCTTGGGCGTCACGTAGTTGTAGCGTCTCTGCGTTTCGAAGTAGTTTTTGCTCATCTCAGTCACGGAAATGT
GGACATCAGCCATGTGGTTTGCCAAGTTCCTTTGCAGCGAAATATCCCCAATATCCTCGAATTTCTCGAGAAAACTGGACGCCACACGCACCAAAGCATC
GCGAGGCCACGGATGGAACCAATCGATTACTGTACAGTTCACTAGACCCGGGAAACGACGAGCTCGAACACGGAAAACAGCGCCGACAGGGGAGAAACAC
ATGACCACGCGGAAGTTGAGACGAATGCGCAGCAGTAAAAAGTCCATGAGTGCATCCATCGCGTCGGGGATTCCGTTAGCCTTGGCTTCACTACGTAGAG
AGCCCAACAGTCCGTCGAGGTCTTCTTTAGGGAAGAGATCAGGGATCCAACCGGACGACAACATGTCGTTGATGTAGACGAGGAACCGCTCGTTGACGAT
CTGAGAGTCCGTGATGAGGAAAACCAAGGGAAGGCCCTGCACACCTGCGATCTTGAACATCTCAGCCAGACTCTCCTTCAAGTCTTCGATACGGAAGTTG
GAAGTGACGGACAGTTGACGCACATCGAAGCCGCAGATGTGAGATGCGAGACGTGATAGAGACTGCTTGCCGCTTCCTCCGACACCGATCAGCATGGCGT
TGCCTCCTGGGTTCCCAATGATACGACAGATACGCGTCACGTGCTCCATAGCGTTGTCGAACAGTTCCAAGTTCATCATGGAATACTTGGAATTATAGTC
GTCCAGCTGCTCCACCAACACCTTATTGAGAGCTTTCATGGACGACACAGGCATGTAAACACTGTCAGCACCAGCCACTGGAGTCGCGAAAGTCGTGAAG
ATGTTTACTGGCACAGGAGCGCTGTCTTCGGAGCCTGGAGGGGGTGGAGGCTGATCGTTAAACAGCGCTACTTGGTCCAAGTCTGGCAGCGTCTTCTTAG
TCACCTCTCGAATCCGATCACCAAACTTGAGAATATCCTCGTCGTTGATAAGACGGTCACAAAAGACGCGAGTGGCTTCGTGGACCCACAGACGAGCGAA
CGAGAAGGCTGTGGGGAAGAATTCGCCCTTAGAGCGCGTGAGGCCTTGGAAGATATTGGACAATTCACGCATGTTCCAGTTGTAGACGAACTTGGTGGCA
CTCGGGAGGAATCTGTTGACCATCTCTTCGTGCAGGAGGATGGATACATTGACGATATTCTCACAGACCGCCACCACTGGAGGAGCGAAGCCTGCGTTCT
GCATGTGTCCCTTTAAGATCGAGTTGTAGATGGTCTTGAGGTCTTCTCGTCCAGGCATCATACACGCGAATAGAGCATAGTGTCGCTGCAATCGCTCGTC
GATAATGAAGGAGCCAGCGGTGGGATTCATAGCCGACAAGTACTGCACGTCCACGATCTCCTTCCTGAAGCCCAAGTCCACACGGTCGAAGAACGTCTTG
TAGTCCATGTGTTGACGCAGCAGAGCCAGCGAGTTTTGCGTGCCGTATGTCTCAATGTACGGCAGATTCAAGTCGTCGATAAAGTAGATCAACTTCTTGG
TAGCTGGAGGCCCGAACATGCGACCAGAGCGTTTGTCAATCACAGACTCGAGTTGCTGCTGTAACTTGGCCGAGTCTGTGTAGTAGTTCATGTTGATGTT
CGAGAAGAGCATGTCGTCGTCGAGATCTCGCAGGAAGTTTTTGAGGATCGTCGTCTTGCCTGTTCCGCTGCCGCCTACGAGCATCGCGGGTCTCTGCCGA
GCCACCAGAGTCTCCACGAGGAAGCGAATACGCACCGAGTCGTTGGTACTGATGACGATCGAGTTGAATGGCGTGTCTGCCGGACCATTCCCGATGGACC
CTGGCGAGTACTTGGGCACCTTTGTACTCCAACTCTCGAATTCTCCCGACTCTAAGTTGTAGAAGTAGTCGAAACATAGTCCATCCTTCGGGTATTTAAC
GTTTGTAAACGTTGAGCACCACAGTTCGTGGAAATTCTTACGGTAATCAATGCTCTTGTCAACGATCAACGGGCCGCCAAACGCCCACGTCGCACAGAAG
ACGAAGATGGACTCAATCACCTCTGGATTCTTCTTCTCCACTGGGATATTGCCGAGTAATCCTTCGAGCAAGTAGCAGATCGTCGACACCTGGTTGATCA
GACGCACAGGAGCGACCTGTTTGTAGCCTTTTCGCATCAGATCGTAGATTGGATCCACGTATTTGTCAAAGAGTCCAGGCAGATAAGTGCGTTCGACTTC
TTCCTCGCGCTTGGCCACCCACGACTCCATGAATGGCCGCCAGCCGATGTCAATCTCGTTGATAAACAGGATTCCAGCTCTTGAGACGGTAGCAGGGGTG
GCGTTCTTGAGCGAGTTGATCTCAAAGACCATTCGCATCGCACTACTCAGCGGGATACGCTCATTCGACACTAGAGTGAGCACTTTGTTGTCGTCCATGA
CGGTGTTCATGGACTCAATCCACACTGCATCGATATCGCCATCAAGCACCACCCACTTGTACGTTTGGCTCTCGTAGAATCCCTGCTCCGAGTAGTTCTT
GGCCATGCCACGCATGATAATGGACAACACGCCATCTTTCCAGTCTTTGGACAACGTCATGTATCCATAGAGTTCGTCAGAGGTGACAGCCTTGGGGTTC
AGCGTCTCATACACGCAGATCTTCTTTTCCTTTCCGAGATTCCAGCACTTGGCCAGTGCCTGCCACGTCGTCGTTTTGGCACAACCCGCAGGACCCAGTA
GCATCACCGAGTGACGCACATCAATCAGTTCTTGCAACTGGCAGATCTTGAGGATGAACGAGTCATCGTGCTGCAAGTTGTTGGCCTTACAGACCGTCAC
CGCCTTCTCTCGCAGCTCCGTATTGACCTTGGGAGCCACTTCGACGCCGATAAACAGATCGTTAATAAGCCGCAGGAAGATCGGCGTGTCGTGGTGGGGG
ATCTTCGGTGTATTGAAGTCTCGTAGCGCTCGCATCAGTACTTTATCCTCTTCAACGTCAGGCTCTGCACGCTTCAAAATACCAGCGACACGGAGTACTG
ATTTAACAGCACGGAGACCCCAATCGTAGTGGAATTGCTTGGACAGCAACTCGCCGCTCAGTTCGTACAGCGTCACGAACTTGATCGCCAGTGTACGAGC
CTGTTGGAAACCTTCAGACATCAACATATTCTCGCAGATAGGCTTCAAGTCTGGTCGAATCATAGCACACGAACGGAAGAGAACCTTGAGATTCTCAGGC
AACTCCGTACGACCAGCGTAACCAGGATTCATCGTGATGAAGAAGCCACACGTTGGGATCAGTGTGATACGATCGGATGCGCCCATGAACTCGAACTCTC
CGACGACTACCGGTGGAGTACCGGGAGGTAACGACTGGTACTTGGCCTCTCGATTGGCAGGGACAGCGTTGAACACGATAGCGTCCTGGATGCACTTAAC
CTGTGTTGCCACCACACTGAGCACTTCGATGTTGATGCGGTTGAACTCGTCAAAGCAGCCCCAAGTGCCAGTCTGACACAACCCACGGAAGATATCAGCC
ATCGTCTGGTAGTTCATTTGATCGGAGCAGTTGAACACGTAGCAACACAGAGCCATCGCGCGAGCCAAGTCTTTTGTCGTCTCTGTCTTGCCAGTTCCAG
CTGGCCCAGCAGGAGCGCCACCCAGGAACAATCTCAACGCCATCGTGAGCGTAATATAACAGCGATCAGTAAGCGGAGTGATCACCAGACGACCAGTATT
GCCGATCCATTCGTA