Description :
From Genome Similarity Track
Location :
Scaffold_282:24595- 25649
Transcript NameFunction/comments
g12839.t1hypothetical protein

Sequence
1054 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGCCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCAGCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTG
AGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCATGCGCCGCATGCCTCGCGGAATAGCTCTCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGTGGGGTTGTCGATGAGCATGTCACGT
GGAATCTTAATGAAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCCCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAACCATTTCAGCAGCAC
TATCGGACGTGGCAGCCGTATGTTCTCTGTCAGACACCGTATGAAAAAGTGGCCGCCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGA
GCCGCCCTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCAC