Description :
From Genome Similarity Track
Location :
Scaffold_37:245930- 246947
Sequence
1017 bases(100 bases per row)
GATGTACTGGTGGCACAAGTTGTACCAACGGGTGGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCACGCCGAACGCGGAGGCGCCA
TTGGCGAGTTTACCGGACCCCACGGGATGTTGGCAGTCCATCAGTATGGACTTTGTGTTTGGCCTTCCGAAAGACAAGGCGGGAAACACTGTTATCGTGG
TCTTTGTAGACCTGTTGAGCAAGATGGCTCACTTAGCGGCAGTGCCGGACACCATCGATGGTGAGGGTACAGCTTTGCTGTTTCTAGACAGAGTATTTCG
CCAACATGGCTTGCCTGAGGCAATTGTCTCGGATAGAGACCCGCAGTTCACCGCGAAATTCTGGACGTCCTTGTTTAAGTTGCTTGGCACGCGTTTGGAG
ATGTCAACAGCGGATCATCCACAGACCGATGGTCAAACTGAACGCGTTACCCGCGTTGTGGAGGACATCCTCCGAAGCGATTGCGCTGAAGCGTCAAAAC
GCTGGAGCGCGATACTCCCACTCGTTGAGTTTGCATTGAATAATGCGGTACATGCCTCTACAGGCTTCACTCCGTTCTATGTGAACGGCCTTGTGAATCC
TCGCGTCCCGCTGTCGCCGCCACGTAGTGGCTCAAGGCTTGACGGGGAATAGCCGAGCGGCTTGCTGATGCCAGCCCTCTTGCGGTACGCATGCAAGTCG
ATGACTTGTCTCGGTGAGAATTAGCGTTATGCGCCAGGTGCGCGACGCTATGGCTGAGAGCCAAGACCTGCAAAAGGAGCATGCGGATGCTCGAAGCAGA
AAGAATATGGAACGGTTTAAGATCGGAGATCTTGTTTTATTAAATGCAAAAAACCTACCTACACACGCAGTGTCTGCCGTATTCTACAAAACTAAGACCT
AGATTCATTGGACCGTTCAAGGCCGTGGCCAGCTAGGGCCTAGCGTACACGCTAAATCTTCCCAAGAAGACGCGCACCCATCCGTTGTACGTTGGATTGC
TCAAGCCGTACCAGGAC