Description :
From Genome Similarity Track
Location :
Scaffold_2:245908- 249339
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001085Similar to arcA: Actin-related protein 2/3 complex subunit 1 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G001084Similar to Smyd1: SET and MYND domain-containing protein 1 (Mus musculus)

Sequence
3431 bases(100 bases per row)
GAGCGACGCAAACCTGTGGCACCTAGCCGAGGGCATTTCGTGCCACGCATGGAACAAGGACCGGTCCAAAGTGGCCGTTTGCCCTAACTCGAATGAGATC
TGGATTTACTCGGGCTGCCAGCAGCCGGACGTGACCAAGTGGCGCAAGGAGGCCGTGCTCACCGAGGTACGTGCGCTGGTTTTCCTCAATTGCGTGTTGT
ACGTGATACTGAGACCTTTGTGGTGGTGGTGTGTGATGGCAGCACGACATGCTGGTGTGCGGGTTGGACTGGTCGCCTGTGACGGACCTGCTCGTGTCGT
GCTCGCACGACCGAGGTGCGTTTGTGTGGAAGTATGAGGCTGCGTACCGTCAGTGGAAGCCCTCGCTTGTCGTGTTACGTATCACGCGCGCAGCGATCAA
CGTCAAGTGGAGTCCGAATGGTGCGTAAATGGATTGTTTCGGCCACTTGTAACCCTGACGAGACAGATGCGAATGCTGATTTTCACGCTATCTTGTGTAA
TGTCCAACAGGCCACAAGTTTGCTGTCAGCAGTGGCTCGAAGTGCGTGTCGGTGTGCTACTACCAGGCGTCGGAGAACTGGTGGGTCAGTAAGATCATCA
AGAAGCACAAATCCACGTACGTACCTACGAAGCTGTCTTCTACTACATGTCTTCACCTATATATTTTTGCCTCTAAATTACATGCACGTCAATCGTGCGC
ATTGTCTTTCTTCTTGTAGTGTGACCGATTTGGACTGGCACCCGAACAGCCAGTTGCTCGTGACGGGCAGCACAGATCTCAAGTGCCGCGTGTTCTCGGC
GTACATCTCGGATGTCGACGGAGCTCCAGACAGCGGTCCGTTCCTTGCGTTGGCCCCGTTCGGTGAGCCACTGGCAGAGTTTGACAACGCGAATGCGTGG
GTCAATGCCGTCGCGTGGTCGCCAAAGGGAGACCGCCTTGCGTTTGCAGGTACCGTACAAACCTTGAAATGCTGCACGTCGAACACGACTGATCCTTCTT
TCTTTTAACAGGCCATGGTTCGTCGATCCACCTGGTGCAGTTTGGTGCCCCTGGCCAGTACCCAACGATCCAGGTATCATTGTAACACTGCTACCTTGTC
TGTCATTGAGCGGAAACTCATCGAATGTCCGTTGTTGTAAACTTTGTAGTCGATTCGATTCCAGCACCACCCGTTGACGCGTCTGCTGTTCTTGTCCAAC
AACTCGATCGTTGGCGTGGGCTACGACTTCAACCCACTGCTGTTCTCGTCGGATGCGAGTGGATTCTGGTATGGCAAATATTGGTGATGTTTGTGAAGAT
CATTATGGATGTAACGCTGATTGTCCCGGTTGTGCGTGTGTGTGCGTGCTTTCAGGTCGTTCTTGGAGTTCGTGGACAAGAAACCAGCCCAGAGCGCCGT
CGCGCGCAGCACCGGAAGCTTCAACACTGGTACGTTTGACCTTCTTAAGTTGCTCTCGAATTGATGAGAATGCTGACTCCATTTTGCTTTTGTGTCCGTC
CACACAGCGCGCAGTATGTGGGAAAGCAAAGTGTCCCGCGGTCAATCGTCTGACGCGACACAAAGCGACAAGGGTGCCTTGTGGACGTACGTAACTTGTG
ATCGCTTTTCATTCTGCGGTCTATTGGTTTGTAGCTGACGCTGTTGGGGTATGCTTTACTCCGTATTGGGCAACAGGAAACACGAGAGCACCATCACTGA
CATCCAGGCATACGCCCGCTCTGCCTCGGGTAGTGTGACGGAGTTTACCACTTCTGGTACGACCCAATCGATGTTGCAACCGATTACTACGCTAAGCTGT
TGATTCTAACTGCGTGCGTATCCTTATCCTTTGTGTTGTGATGTTCAGCTCTCGACGGTCGTATTGTTTTGTGGAAGCTGGCGAGTTTGAACGTGGAAAT
GAGCAAGCTGCGCCTCTAAGCATCGACAAAAGAACGAGTTTTGACTGAGAGAAGCACGCAAAGCTGCAACCCAAGGCGAAGAGAAGTAGTCGATTCACAG
AGTAGTTGACGCGAACGAAGCACAGAAAAATGATTCTCGCAATGCCGCCGCCATTTTCAAAAAGAAAAAAATAAAGTGTCTATTCATACAATCGCTTAAT
CCGACGGTAATCTTGGCGGTACTGGTTCTCCACAAAGGATGCCTGGCGAAAGTCTTTCCACTCCGAAAACTCCTCGAGAAGCGCGTTTGGATCGTAGGAC
AACAGCAGTTGGATGCCCTGGCTTACATCGTTCAACGTTCGCGCAAGGTCCATGTGGTTCTCGTTCAGGTACGCGCGCTGCAGCTCAAGCAGCTCGTAGC
TGCTTCGAAGGAAGAGAATTGCGTACTCGCAAATGTCTTGGTTCGGTTTTGCTCGAAGCAGGAGATCACAGCTGTCGGCCACGAGTTTGTGGATTCGGAT
AAACACGATATGATCGTGCGCCACGATCTCCAGCGCATCTGAGAGCGTCTCTAATGCGATCTGAAGCACCTGAGCAACATTGGCGTGGTCCTTCAGCAGT
TCTTCAGCGGCGGCTAGTATTTTCTCGAGTTCTTTCATCTCCACCCGAGCACCGCCATCTTCAGTATCATTAGATGGTTGCGGTGGTGGAAGCACGCTAT
CGCCTCGTTGACATAACTCGCAAATGCACACGAAACCAAACTGTTCGCGCAGGTTTTGCTGGCGGTTCTCGCGACTCTGTTCACGCGGGTACAGGTACGA
AATGGTGAGTGGCTCGCCCTTGAGAATCTTCTTCGCCACGCGAACCTCCGAGATGCCATTCGCAGTCGACTCTGGTGTGAACTTGACGCAGTTGGGATTG
CAGTCGTGGTTGAACATCGCGTTGTACAGAAACACGCCACTGTCGAACGCATTGCACTGCATCGCGAACACGTTCTGCAACAACGCGTCTTCCGACAACT
CCAGGTGCTGGAAATCGCGGCGCAGCTGGGCCAGCAATTCGCCATATTTTTCTCGACCAGCGACGAGCAATTCGTCGGGAAGTTCGCTCAGCTGCTGCGG
GTGGAGGTGACCTAAATGCTGCATGATATCCTTGTAGTCTTCGCGCGACAAGATCGTTTCGAGCGTCGCGATGAAGAACGATGGGTCCGATTGCTCGACA
TCATCGGGCCACGGCACGTACACCTGCTCCACAAGCACCTGCGTTCCGGACTCCAGGTCTCTCGCCGCAATGTACCCTCTGTGTCCTCCGATGCCTCTAC
AGTTGGTGACCAATTCGATCGGCCCCACAGCCAGCGGCTTGACGTCGTCCCACGGCGCGTACAGACATGGCACATCCTGCTCGTCGGTACTCGCTGCGTC
CTGCGGCGCAGTGGCGACTGGCGCAGGTGGCGGCAGGATGCTAAGCGTCTCGACCGTCGTGGCCACCACCTGCTCGTCGTCGCTGCTGTCGTCGTCAAAG
AGCCCGAAGGCAGCCTGCACGGACTCACTCG