Description :
From Genome Similarity Track
Location :
Scaffold_1479:2459- 4030
Transcript NameFunction/comments
Phypl_g13517reverse transcriptase

Sequence
1571 bases(100 bases per row)
GGGGCACGTTGGAAGACGTTTCTCAAGGCGGTCCTGAAAGGAATGATCTTAGGCCACTGCGATCTGGACATACTCCTCGATCCGTTCTTCCGGCAGTACC
CCCGGCACAACGAGAAGCGTTTGTGGTATCCGGGTCTTGGACGCCATCCCCAACCTGTCAACCTAGTGGAGGCTCTCCACGCTGTCGACTTGGCGGAGTC
GTGGCGCAACCAGTATCGCGCCAACATTCAAGATCACCCCGGCTCCCAGATCGCTCGTTTGGTCGACAAATTCACTTCCGTCGACGCCAATAGTGACGAA
GAATTGGCGATCCGCCTCGTGCCATTAATAcaacttcttcgtcttcttgatCGGGATAGTTCGTAGCGTTCCCTCACTCACTCATTTAAAATAAATTCCC
TTCCACCTTAGCGCGCAGCCATCCGGCACGCTCTTCACTCTACTCCTCCCCGCGGCAGCCAACCTGCTACGAGTCTTGCGTCGCTTCCTCATGCGACTGC
ATCACTCCAAATCGATTGCGAGTGGTCATTTCACGATCGTATTCACGCACCGCAGTTAAGATCGGCTTCGTCGACCCACGACGGGTCATCGTAGCCTCTC
CAGTATACTTTAAACTCGCGGTGGACGCGCCCGTAGCGCGTACGTCGACCTTTCCGCATGTCCTCAATCCGTTCAACCTCATACTCGCCATCGCTGAGCC
TGCGCTCCCAGCTGTCCTCCGGCAAGACAGCTTCACAGAAGTCAAAGCGATCCGTCTCCTCTCCCACCAGCTCGATCTGGGGCCGATCGGGAAACACCCG
CACCAGCTTTAGCTTCGAGACATGCACAATGGGGAATAGTCGATACTCTGTCCCACCTGTCTCCAGATGTGCAGCGTGACGATCCACCATCTCGATCACC
CGAAACGGCCCATGCCACATATGAGCTAGCTTGCGCGCATAGCCCTCCTTCACACGATCGAGATATAGCCACACCCGTTCGCCCTTTTCAATCATGTGGG
GTCGGACAACTTCGTTATGCCAATCTGCGCGACCCCGAATCGCTTCACGTAGGCGCTCATTGACTTGCTCCCTCGCTCGTTGATAGTGCTGTTGCACATG
ATACCGCCATCGACGCGGCTCACTGTCTCGGCGCCGCGTACAGCCCAGCGGTAGAGATGCCTCCAGCGTTGATCGAGCGTCCCAACCGTGGACCAAATAA
AATGGGGTGTCTCCGCGGACGCAATAATGGGTCGTGTTGATCGCAAACGTTAGACGTTTTGCGTACTCGTCCCAGTCTTGCTGATTCACGTCTGCGACGT
ACATCTTGAGTGCGCGAGTTAACGTCTGCATCATCCGTTCAGCCGTTCCGTTAGCTTGTGGGCGGTACGCCATCGTGGCCTTCTGTTTCTGTCCGACTAT
CCGGCTGAACGCACGGAAGAAAGCAGACATAAATCCGGGTTCTCGATCGTGTCGGATGGCTTCACTGGCTCCGAAGCGTCGAAACACGCACTCCTCGTAA
TTCTCCGCGATAGTCTGCGCTGTGCGCGACGCACTCGCCTTCGCGATCACATAGCCCGAAAACAAGTCGAC