Description :
From Genome Similarity Track
Location :
Scaffold_1160:2459- 3991
Transcript NameFunction/comments
Phypl_g12604conserved hypothetical protein
Phypl_g12605conserved hypothetical protein

Sequence
1532 bases(100 bases per row)
GGAGCCGTCCGACCCAGTAAAGAACTCCGGGTAGTTGGCAATACTCTTGCCCAGCCGCTACACCATCAAACCAAAGCAATAGTATCAGCGTCCACAGTCA
TCTCCCCACACAATCCCAAACCCGCAATTTACCTTCAACAGGTCCGTTCTTCCAGCACAACCCACCAACGGGTTCGTATCACTCTACACAGCAAAAAATA
AATAAAAAATAAGAAAACAAAGTGTTGAAACCCGAATCTCCGCACCACTTGGAAAGCTTTTGCGATTGCGTCATCGGCCAAATTTGCCAGAGCAGTTGCG
TCCACTCGGTGCGGGTCGGTCGCCGGGTCCTTCGAGAAGTTTCCCTCCAGGAACATGTGGAAGCTGGCGATGCCCAGCCCTTCGCTGCGACTGTACAAGT
CCTCGgtgcccagctccttgtaCGTCCACGTGGGGCCAGCGCCCGCGTCgagcaagacgctgacgagCGCAAGGtccagcagacgacgagccgTCTCCAG
CTTGTCGCAGTGCCAGGTTGACGTCAtctcggccacgcgctgcggGTTTCCGGTCTCGAAGTGGCGCCAGCGCGAGTGGAACGGGACGTTCGCCTCGTTG
GGCGGCGGGTACGACTGGCAAATGACGCGGATGACGTAATCGGCCAGGGCCGGGATCTTCTCTTCGACCACCGAGAAGTGGGGCAGCTTGTCCTGCGTGC
CCAGCGTTAAGACGCGGTGGCAGCCGTCGCGCACCGACGGGAGCGAGCGCAGATACGCCACTTGGTCTTCGGAGGACATGGCCATCGCTCTGATGTGGGA
GGGGAAGGAGGGGATTAGCGAGTGAGCAAGTGGGTGAGGAGAATGGCTGTGCCGCAAGggaagatggctacacgcACGTCTTCTCTACTCTTGGTCTTTG
AAAGTGTGCTCCTTTTGGCACCTGTTCGCATTCAACATGATCTTGTTCCGGATAAGTGCGAATATTTGCCCGCATATGGCGTTGAGTATGCTGggaagct
cgagcttcaaGACTGTTGAAGAGAATGACGGAGTGTAGTCATTAGGAGAACAATGTAGACATGTAGGCCCAGTCAAGCTCCCTCAGTCAAGGTCAACAAG
ACAAAGTCTGCTTTCCGTTTTAAGTTCTTCATTCTTCATTCATTGCGGAGTTTCCAAGGCTCgaacgacgagatggcggaAAGTGAAGAGCGCTTTATCC
TTACGAGTGTGGAAGTCGTGTGTCGGCACTGCTCCAAGTTGGACGCGCTGCCGCATGTCGTGCATCTCATCCAAGCGTTCACGGAGAATATCTCGGAACG
CGCACTGGTGAACGTTATCAAGCAAGGGAAGACGCATCTGTTTACTCGAGTGCTTCACGCCGTAGACGAAAGTTTGAACATGGTGTACCACGAGAAGTTG
CACCAGTATCGTGTGGCAATGGAGTGGGTCCCGCATAGATTTAGGTTGGAAGATGGCGAGCTGGATGCCCTGAAGGAGCTCTACGAGCGGTACCCCGGTG
CTCTAGATTCGGCGGTTGTCGCAGCCATTACT