Description :
From Genome Similarity Track
Location :
Scaffold_2025:2459- 3584
Transcript NameFunction/comments

Sequence
1125 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACATTTGGTTCACCTCGTACCTTAGTGCAACATGCACTACGGGATACAT
TCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGG
GTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAGACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGC
TATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCTACGCTTCCTCATACACGTGCGCACA
CGTGTAAGCAAAAGTAGTGGGTCTAAGCAGACCCATTACAGACGTGGAGCATCTCAGTGTGGGTGCTGTCCAACTGAGAATCAAGAACTACGTTGCTCTC
ATGCATATCAAGAATCCCGACTGGCATGTGTTGGCGGAGACTGATTCTTCCAAAGCTATTGAAGTCGCTGATGCCGAGTCTGACCACGTCGCTGCAGATG
ATCTCTACGAGGCTTTTGATGCATCGGATCTTCTTCTAACCAGCCTGGACGAGGTTGAGGCAATTCGGAGCATGCGGTTTGAGCCGTCAGCGCACGTTGA
GGCACCTTCATATTTATATGAGCATGTAGATGGACTACGAAGACTTACTTGCGTCCGGAATACAAGCACCTCTTCGATCACTCTGCGAGCTCCAGTTTCT
TCGCGTACCTTCCTTTGTATTTTTGGCGCCAAGTCCTCCACGAGACGAACCGTTACACCGCTCTAAAAGAAGTGAAAACATCTACGCCATTCACACTGTC
GGAGTTGATGGCGTTCCTCGGGATTATGTTCTTCATGGCGGTCAACGAAAAAGGGGAGTACACCAACTACTGGGGTCCCCAGCCGAAAGACCTTATTTTT
GGTGGGGCTACAACTTCACTAGACA