Description :
From Genome Similarity Track
Location :
Scaffold_27:245889- 252911
Transcript NameFunction/comments
Physo_156792hypothetical protein
Physo_133655nuclear serine protease HtrA2/Nma111, putative

Sequence
7022 bases(100 bases per row)
CGAAAGCTGAAGTGTGGACACCTTGCACATTGCTCTGAGCCTGCGCTTCGTACCAGCAACTGAGACCAATATCGTAGTATCTCTCTGCAGCCACCGCGTC
AGGTCCGTCAACAACCTCCTTTTTGGTCTTTCTGGAAAGTAGCACTGCAGCCTCGTACGCCTTCATTCCGGTGCTTATGAACTCAACCCAACTGGATCCC
TCGCTCGAAAAGTTTTCTGGTGACAGGTAGAACGCAAAACAGTGGATGTCGCCGATCAATTTGCACGCTTCCACAGATCCAGATAGAGGCGAGGTAGATG
GTAATCCCTTCATTAAAGTTGAAGCCTCCTTCAAATTGGCCGCGGCATTGCCATACAGCCCTTCAGCACACAGGTATTTTGCTTGCTGGAAGAGCAGGTC
CGCGTAAATCATTGATGCAACGGTTACATCCGGATCACCATCCGATAGGTCGCCGGTGACAACCGGTTTAATACGCTCCAAAGCATCGTCGAAAAGTAGC
AATGATCCTTCAATCCGTGCCAGTTCGCACCGAACGCACCAATTCTCTTCACCTACTTCAATGGCCTTCAAATACGATCTCTGCGCGGAGACTTGCTTGT
CGAAATTCTGGTAGATGTGAGCCAGAATGACCCAGTGTTGGGCGTTCATGGGATCGTTACGAAGCACTAGGTGCATCTTACCCACAGCACTCTCGTCGTT
TTGTTCGACCAAGTGCTGAGCAAGCCGCAGGAGTGCCCATGTGGGAGCAGTTTCTTGATCCTCAGTCACTCGTTCCCAAAGTTTGACGTTGGCGTCATAC
TTGCCTTGAACATCATACAGGCTGCTCAAAGCCATTCCCGCAAGCCCATTCGTCGGAGAAATGGAAAGAGCCTTCAAGAAACACTTTTCGGCTCGCAGAA
TATCTTGCGCTACTTCTTGATACCATTTGCCGAGCCAGGAGAAGATTTCCGCATCCGACGGAGTCAGCTTGGCGGCTTGAAGGAGATGACCGAAGCACCC
TGCCTTGGCTGTTTGATGAGAGCCACCGAGGTGCCAGTACACAATGGCCAGCCGCTTGAGAGTCCGCCCCTTATCGACAACATCAGTGACCGGAATCTTG
CTCACATTTGTCTCGAATAGTGACTGAGCCTGTCGAAGATCACCAAGCTGGAATTGAAGCCATCCGCGCGTGCACGATAACGCCGCGCTCATGTTTTCGT
CCTCTAGCGTAGATGCCGTAACCGAGTCGATAATTTCCAAAGCCTCCTTCGGCTGCGATTTTGCTGATAACAGTTCTGCGGCTGCAATCGCCGCTTTCAC
CGCGAGATCAACGTCTCCGCTCTCCATGACCCCACGGTAGCTCTCCAACGCTTTGTCCGCATCGCCGGAGAACTCACACGCCGTTGCTGTCATGAACAGC
ACCTTAACCTCCGAATACCTGAATCACGTATGCCCACGTTAGAAGTCCAGCATAAAACTTTAGCAATAGGCATATTAACTCACACAGAGGGGAATGGGCC
TTCAGATCCAAGTGATTTCGACTTGTCAGCCACCACCTTTTTCGCAAGAGCTAAGCGATTCAAGCAGCCCTCAACATCGCGTGCGGCGAGTGCAATAGAA
GCAAGCTCAACCTGGACGCGAATACAAAGAGCGCATTCTTGAAATGACGAGGAGGAGTACCCGGCAAGAGCTTCAGCGAAGTGCTCTCGCGCCTGTATGT
TCAACGTAAAATAGTTAGAAGGAAGCATAACAACGGCGAAAGTATGGGGATATAGGCTTGCCTGGTTGCTGTCTCCCGAACGCAGACACTCGAGTGCTTG
ATAAACAAGAGCCATTGGGCTCTTGGAATGAGTGGCTGAAAGCCCCTTCGCGATTTCGGTAGCCTTATCCAACGTGATAGCTATCATTTAGCCACAAGCA
CCACGACAATCTCATCAGACTATAATTGGCAGCAGATAATGGGCATACCAAATACTCACGACTGTCCTGGTCCTCAGCTCGCAGCAGCAAATATTCCGCT
GGGATCTTTAATCCTGGGAACCATTGAATGATTGACGTCGCGAGCGCATCCACCGTTTTGAGGAGAGAAGATTTTTTCTTTGACGTCTTCAATGCATCAA
GGTGAAAGCGCATGAAGTACGCGATGGCGCCGTCCATTCGCGGCCGAAGCACATCGAGCTCCTCGGTCTGGGCTGTCCAGTCTGTACGAGACGTCACGGC
AAAAAACTGGCTTGAGAACTCGGCGGTCGAACAGTTCACCGAGCAATCCGATAGCGTGAATCCAGGACGCTTCAGCAACACACCACCTTTTCGTCAGAAC
ACGCATCAAAGGCCAACCAACCCCCCGGCATTTACCACACAATACCTGAAGCAAGTCAACCAAGTCCAGCCAGATATTCAGCGGCGACGGCAGCTCCTCG
TTCGGGGTCTTTTCAAGCGAGAGCTGTCCAGCATCTCCAGGCTGCTCCCCGACAAGCGTGTACCACGAGTCGAAAGCCTACGCGACATCATCACAAATAA
CAGTCATAAGCAAACTACGAAAGATTCTGGCGGCTGTACAGCATTAAGAGTCTTGATTCAAGACGCCATACCTTCGGCAGCATCTTCAGCTCCATCGCCG
CGGCCGCCACTTCCGCGACCCACTTCTGACAGCGCTTCGGTTTCTTGCCACTGCAACGCCAACAGTCCACAAACACACCAGGACACATCTGCATCAGTTG
CCATCCCACCAACCTCGCCACCGCAGCCGCCGCACCTCAAGTTGATCTCCACGAGCTTCTCCAGCGGTTGCAACTTGCTCTTGACATCGTTCCTCGCCTC
AAACAGATCCACGAGATACTGCGACCACCCGAAAGCTCCACTCAGTCTCCCAGTTATACAAGAACCAGCCATGGACAGAAAAGTCTAGGCACCTTCCAGG
GCGCCGGCATGTCCGGTTTGATGTCGGCCGCTCGCCGGTACGCCTCCTCACAGTCTTCCCACTACAGCAGCACAACATAACAGCGCTAAGCACAATGAGA
GAGAGAGGGACGAGGTGGACGGACGCACCTGCTGCAGGTGGAAGCTGGCCAACCCCACGCACATGAAGGCCTGGAAGTTGTTGGGGTCGAACTGCGTCAC
GCGCCTCCCCGCGTCCTGCGCCTCCTGGTAGCGCTCGGCCTTGAGGAAGGCTGCCGCGTCCACCAGCATCTGCCGCAGCATGGTCGCCGACATGGTGCCA
ATGCAGAAATGGGTCGGATACCCAGCGAAATGGGTCGGATACCCAGCGAAATGGGTAGGATATCGGACCCAGTTTGATTTGACACCGAGCTCAAAACTTA
TTTGGATCAAAGTTGAACGACCTTCCCATTCGCCAAAAGTCCCTCGGATGTGGAAGGCCGGAGCTCGTGCCGCGGCGACGCCGCTGCGGCGCTCGCCAGC
GTCCTGGCGGCTTGGCGCCCGTCCCCAACAGCTTTGTCAGCGCCCGCGCGCACTACAGACGCTGTCCACGGGGCTCGGAGGCGCCGTGCGACCCTTCTCC
ACGTCGTCCTCGTCGATTCCAAGTACGTAGCGGATTGAGGGTCTTGTATTCGGGGGATAGCGAAGAGTGATTGTCGTAGTAGGGTTGTGATTGAAGTGGA
GTTGACATTTGTGGGTCTTTTTGCGCTGGGTGATTGGGTTTTAATAGCGACGCAGAACGCGCAGATGGCGGTGGCCGCGCTGGCGGCTGCGGGCGTCGGC
TACCTGTTCGTGAGCACGGAGCGCCAGAGCGACCAGGAGAAGCAGCAGCGCGAGCTGGAGATCCAGCGAGAGCGCAAGCTCAGCGATCGCCTGGCGGCCG
AGCTCGTGGCGGCCGAGGCCAACCAGAACAAACTGGACTGGAAGGCCACGCTGGAGCGCGTGGTGCCGGCGATCGTGTCGCTCAAGCTCAATTCGCCCAA
GGTGATGCAGTTTTTATTTGTTGTGGATGGCTAGCAGCAATTTGTGCACTGACAAATTGTTTTTTTTTTTTTTTAGTTTTTCGACACGGAGTCTCCAGGC
AACGGATCTGCGACGGGCTTCGTGGTTGATGCCGAGAAGGGAATCATCCTCACGAACCGCCACGTCGTAGGACCAGGACCCATTGTATGCTGCTCTAATC
TTGCGAAGCCGGAAAAGAGGCTGGATATTTTTTTTACTGACGAGCTGTTGTTTATGGATTGCGCTGTGCAGGATGCTGAGGCTGTATTCCAGAACAACGA
GGAAGTTCGAGTCATTCCCATTTATCGCGATCCGGTGCATGACTTTGGCTTTTTCCAGTTCAATCCAGCGGTATAATAAGTTGATGCTGCATCGTGCGTT
CACGATCCCATATTCTTAACTTTAAATCCTTTTTTTGATGTGCAGGATGTGAAGCACATGTCGGTGCCGTCGCTGCGACTGGAGCCGGACAAGGCCACCG
TTGGGACGGACATTCGCGTGGTCGGCAATGACGCTGCTGAAAAGCTTGCGATTGCTAGCGGCACGTTGGCACGACTGGATCGCGATGCACCCAATTACGG
CTACAACAACTACAACGACTTCAATACGTTTTACTACCAAGCTTCGTCAGGTATGTCTCCACGAATTGCGGAAAACTAATGTGCTGTTGAAAAGTGCTCT
AACGATTGCAATTGTGAATATCCATCTGATAGGAACCACGGGAGGTTCTTCTGGTTCCCCGGTGCTTAACCACGACGGTGACGCTATCGCTCTTAACGCG
GGCGGGAAGATTGGCACGTCTGCTTCCTTCTACCTGCCCCTAGATCGTGTAAAGAGAGCGTTCGATTTAATCAGAGAGGGTAAGGACGTGCCTCGAGGCA
CCATCCAAACGATCTTCAACTACAAACCCTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACCGAAAGACTTGTTCGCTCCTCCTTCCCGTTGGC
GACAGGTATGTTGACGGTAGCTGAAACGATCCCGGGCGGCCCATCGAGCAGCAAGTTGCAGCCAGGCGACGTGCTGATTCGCGTTAACGGTGAACTGATC
ACGCGCTTTGTCCCGTTGGAAGCCATTCTCGACGAAAACGTCAGCGAAGAGGTACGTTTTTTTTCATTTTAGGGCCTGTGAGATTGAAAGCATGGCTAAC
CGGTCAAGTGAAATTTGGGTAGATCGAGCTTCAAATTGAGCGATCCGGCGAGTTGGTGACGCACAAGCTACAAGTGCAAGACCTGCACGCCGTTACTCCG
TCGCGTTTTATTGAGATCGGCGGTGCGGTGATTAACCCACTTTCGTATCAACAAGCACGAAATCATGCAATGAGCCCTGGAGCGCCGTACGTGGCGGACC
CGGGTTACTTCCTGCAGCGTTCTCGCATCGGCCGCGGCGCTATCATCCACTCGGTGAATGGGATTAAGACACCCGATCTCGAGACGCTTAAGAACTATTT
GAAGCAGTGCAAGGACCGGGATCGCATCGTGGTCAAATTCTCGAAGCTGACGGATAAGCCGGAGAAGGTCGAGGTCGTGCATGTGGATCGGAGGTGGTTC
CCATTCTGCGAGTACGTGCGCGATGATAAGCTCGGCACGTGGCATTGCGAGCACTTCGCCCCGCCCGCTGAAAGCACGGGTACAGATGCCAAGCCTTCTG
GAGAAAAAGAACCGATTGGATCGACAACGACACTGCCTGGTAAGAACCCGGTGGAGAACAAGCTAGCGCGCTCGCTAGTAACCGTGGACTTTGATCGCCC
ATTTAGCGTGAACAGCTTGTCAACATCGAACTACCGTGGCACAGGACTTGTGATCGATGCGGAAAAGGGACTCGTGGTGGTGGATCGCAACACCGTCACT
GACTCGATGGGTGATGCTATGGTAACCTTCGCCAGCACTATCATGGTTCCAGCGCATGTGGTTTTCGTGCATCCGGTGCATAACTTTGCCATTGTACAGT
ACGACCCCAAGCTCATTGGGTCAACCCCTATTGAAAGTTGTCAAGTGGCATCCAAGCCGTTGGTACCCTCCGATCCGGTGTGGCTCGTGGGTCTCATGAG
CAGTGTGGGGCGCAGCGGCCACTCGGATCTCGTATCCCGGGAGACCATCGTATCTGGCGTCAAGTGGATTGGGTTGCCCATGCCCAACCCACCTCGGTAT
CAGGAACACAATCTTGAAATGGTGGCTTTGCAGGATGTCGTTGGAACTGAAGGCGGAGTTGTATGCAGTGATAAGGGCGAGGTGAGTGCTTTTTGGGCTT
CGTTCTCGTTCCAGCAGCAGCGCCGTAGCTCCAAGGTGGAAAGTCAGTTTAACCGCGGAATCCCGATGGAGCTGATTATGGAAAGCGCGGCACCGCTCAT
GCGAGGTGCGACGCCCCGAATTTTCGATCTGGGGGTGGATTTTGAGCACTTGAGCTTGGCAAAGGCTCGGGAACTTGGGCTTGGGCAGGCGCTAGCTGAG
ATTTTGGAGAAGGATGCGCCAGACCGCCGAACTATCTTGAGTGTTGCGCGTCGGTGGGGTGGCACGGAGGCGAAGGATGTGTTGAAGAATGGCGACATCT
TGGTGGCTGTGGACGGCAAGATCGTTACAAGCTTCCGCGAAGTGGAGCGTTGTACGCAGAAGCCGGAAGTTCAGCTTACGATTGTGCGAGATGGACGCGA
AATGCAGTTGGATGTGAAGACTCTTTTCATGGAGCGCACGGAGATCAACCGCATTGTCTTCTGGCAGGGTTTGCTTCTTCAGGCACCGCCTCTGTCGGTA
TCAGCGCAGCGCAGCATCTCACTGGAGGACGGTATCTATGTGTCTTGCCGATACTCGGGCTCACCTGCTGCCCGCTACGGCCCTCCACCCACGAGTCGGA
TTAAGGAAATCGATGGCGTCAAGATCACAAGTATCGACGATTTCGTGCGCGTCGTCACTGCAAAGTCAGGAAATGACTCGGTGCGCATCAAGTACACGGA
TCTGAGTGGTAAGGACCGCCTCAGCACTCTCAAGCTTGAGCCGAAGTACTGGCCCACCAGCGAACTGGTGCACGAGGGAGGCGAATGGCATCGCCACCAG
CTCTGATCGCAGCTTCGTCCAG