Description :
From Genome Similarity Track
Location :
Scaffold_3:2458548- 2459997
Transcript NameFunction/comments
Phyin_T30-4PITG_02532Ca2 :Cation Antiporter (CaCA) Family

Sequence
1449 bases(100 bases per row)
ACAGAATCTGTTGCAATACCACAGTACAATTAGATCTTTTTACTGTTTGGGATTCGGTGTTACGGTAGCACTGCTGCATACTGCTGTGGAAACAGCTCAT
GCATTCACATTGAAGATGCAGATCACGGCCATTTAAAGCTCGAGACTACGAACAAAAACAATTTGCTTAGAGAGTAACATACTCGAGAGTCACGAGTCGT
GACGTAAGAAGCCATCTCGACAGAGTTTGTATCACAGAGCTAGCAATGTTGTGAAGTAGTACTACATGTATAATAGCAGCGCTTCTCACCGTGACCGTCA
TGCTCACATACTGGTGTGCAGGGGTCTTGCCAGGACGGCGCTGAAAATGAGACAGGCTGTCCGCCATAGTAATCCCCCCCCCCTCCTCCATTACGAAGGC
CTGGGGTACATCTGCATACAGACTCGCCAGGACAGCTAGGTATGAACCACAATAAAACCAGCAATGACTCCATAGCTGTTTGCTGCTGGCGAGTCTATAT
GCAAACGGACCCACAGGTTCTGTAGTATGGCTGCCACGGTAGTGACTCAGTGACTGAGGCACAGCCAGTAACTGTGGATTGCCCATTGTACAGTGTACTG
TACTTTGATGAGCAAAGCGGCTGAATGATGCGTGAAAAATCCACTGATTCTAGTACGCCAAAATTGGACGCCGTACAGTTTCCCGGCCAGTCATCAGTGA
TACTATAATAGAACCTCTAATTGTGGAGAGCACCAAAAAATTGCCAGGAAGGATATCGCCGAGCTTTACTCATCGATTTACGTGCAGCGCCTTGCAAAAT
GACGATTTTGGGAGATTTACAAGGTGCTTTTGGGTACTTCAAGATTCAAGAGAAACTACTTAGTCGAAAACTGATTTCGAGCAATCGGTAAAAACGGGGT
ATCTTGAGTTAGTTGCTCATTCAGAGTGGCTCATCTATCATTTATATCGAATAAAAAGCAAGTTGCATGAATAGAGCTGCAAATGCGATCCTTGTGGTCA
GTCTCACAGTGAGACTCTCACTTGGCAAAAGTACGCGGACGTGACAAGCTTCAGAGCAAGACTCAAGGACGACAAGTCATGTCGGGCATTTTCATCGACC
CCAAAGATCTTCCGGACGACGGCTACGGCCTCGTTCAGGTGCTCTTCTTGGGTGCCGTCTATGGCTTCGTGCTCTTCAACGCGAGCAACCTCATCTCGGA
CGGCAGTGAACTGTTGCTCCTCGTTCCATCAATGGCCGGCATCGTCGGCAGCGTCGTTCTACCTGTACTGGGCGCCGTGCCCGACGGTGCTATCGTTCTC
TTCTCCGGTATGGGTCCGAACGCGCAGGAGCAGGTCTCCGTGGGCGTCGGTGCACTCGCTGGCTCCACCATCATGCTACTCACTATTCCATGGGCGCTTA
GCATCTACGCCGGCCGCGTCAACATCGACGAGAACGGCCGTGGCAGCTA