Description :
From Genome Similarity Track
Location :
Scaffold_2091:2458- 3508
Sequence
1050 bases(100 bases per row)
CATTATCAATAGGCTGTCCGCTTGATGTGCCTGCACAATATTCCTCGAGTGTGATGCAGTACTGACTCGCCTCGCTTGATCGATTCAAGGTAAATTACAC
CGCCAGCTTTCACGCAATCTGCCGCAATAGATGAATGCCTGCGCGGATTTGAATCGGGCGCGACTTGGCAAGAGACTACAGACAAAGTGCGTGCCCCGTT
GTTGCGCCTTTGGAAAACAGACGATGGGAATGAGTGAGGCAACTGGTTGATTGTCTCGCTCTTCAAGGAACTCAAAATGCATGCTCAGCACATAAAATAA
GTCTCATGATGCATGCTCTCGCCCAGATACTCAAGTGTTCGAATGGCTACAGGTTACTGTATTGGCTAGTTCGTCTCCTTTTCAGTAGCATTTGTACCCA
TTCCCTACATCAACGTCAACCCACACTAAGGAACATTTGCTGTTTTCTGATCGAAGCCTCTCAGTATGTGCGGCCTCGATGTTGTAGCACATTGAAAGAG
AGATGAGAAACCATTTCAGATACATACTCTTCAGTGCCCAAGCTGAAGTCGCAGTCATACATTTGCAGCAGACTCGAAAGGAACCGAAAATCGTCCACCA
TTCTTCGTTCTATCACGCCACACCAGCGTCATATTGTAGTTTTGCGTTGCACTCACGTTTCGTGACGATCTGCCGACGCCGAGACCGTAAACAGCACTTT
CGGTGTATTATGTTCGTTCGCAAGGACTCGGCGTCTGTGCGTCCATTCGCGGTGTTGGTGTCCACAGTGGACAGATCCGGTCTCTCGTTCCACCATCATG
AAATGACTATCCACATGCTACTTCCAGTCGAGAGTCCAAACAGATCTCATCGTCTCTGAGCGGCGAGCGCAAGCACACATGATTATCGAAAATCGGATGC
CTGCCGTATGAGGAACGGAATTGCAGAGTGATTTGGCTCATACACGCACCCTGTAGCCTTCATTTGAGCACATTTGATGGAGCAACAGCAACCACACATT
TGTGTGAACAGTATGGATCGATGGACATACATACAGCGCACTATTGGAAG