Description :
From Genome Similarity Track
Location :
Scaffold_26:245693- 251059
Transcript NameFunction/comments
Hyaar_Emoy2804173hypothetical protein

Sequence
5366 bases(100 bases per row)
TCCGAAAACTTCGCAGCAACTTCGTCATGTGTTTCGACCTCGACGAGAAAGCGGCTCAAGTACCGGAAATGGGACTGACAGACTTGGGTCGTGAAGCTTT
GAAGCTTCTGACCAAGCTCACTTCGACTCTCAACGGTATCTTGAATGGTCACGCAAAGAAGTGCGTGGACGTACCCCCAGGAAAGTGTTGTTCGCTCATC
CGTCCACGCTTCGGACCAAATGTCAAGGAATAATGCGCTCGTGCGGGCGTCAGTAGCAACTAACATACCAATAATGAGCTCCATCTTGCTTCTCACTAGC
TGTGCTGACTGGCTTCTCACTGCATCGAGGTCTTTGGTTGCCACGCAAGGAGTGACGGGTGACTCACTAGAACCGCTATACCTGCTCGATTGTTCGAGCC
ATTGGGGGTCTACTCCACCAAAGACAAAGGGCGTATAGTCGCGGATGATTGCACGCAAGGCCGGTTCCTGCTCTGCAGCATGACATTGAGGAGACAGGAC
GAAGCTCAGAACGTGTTTGGCAAACCATTCTGGCTTCTTCACACTCAACTTCATTGTGGAGCAAACTAAAAAGTCCACCAACTCTTCAAATAGCCCATCG
TTGCCTGCTCCATCGAGCCGTAGTTTTCGGCGTTGTTCCAACCACTCCGCCATAAGTGAAGAGCTCCAGTCTGTACTAGCGTGCTTGAAAGCCCGCACCA
TGCAGTCTCGGATTAAATACGAGCGTGACTCCACGAGCAGCTTCTTCAACTTGTCGTCAGCCAAAAGCAGCTTCACAAACCCGCATGTCATCCGACACAC
GCGCAGCTTGCCTTCCTCTGCCAGTAGTTCCACCAGCTGCTGCGCAGGATCTTCAATTCGCCACTCGACATCATCTTCGTCCCGCAACGCAACGTCTTCA
GCAACTAAATTGCGACACAGCAGTGCTCGCCACATGGTGTGTAAGACACTGTCACTGCACTCGGCGGCACACGCTGCAATCCACGGACTGAGGACGAACC
TGTCCGCATTGTGCTCCAGCAAACATCGCAACAGCGACCTGCACACTAGCTCATGACGACATCTCCACTCTGGTCCCATACTTACACTGCAAATGCGTGC
AAGCGCGTCTGCAACGGGATACTTGCTCGTCGAGATCGAACCGCCAACTTTGCTCATTTTCTCCAGCATTGCAGGCAGCAGCAAGTCAATAAATTCCGGT
CGCTTGAGCAAGAATCCCGCCAGCACTTCATCCAACAGCGTGGGATACGTGCACGGATAATACGCTGCTAAGAGCGTCGTAAGTTCCTGCAAAAAGCTCG
AAGCAAAGCCTGAGCGGTAACACCAATTCGTCACATGATTCCCCACAACCTTCACCAGCACAGCTCGACTCAATTGCACATCCACTCGATCCACTAGTCC
CTGCGGCACGAGCTTCCCAGCATCCACCCCAAATTTCAACCCATCCAGCTCCGTTGCTGCCAAAAAGTCTTCACTCCGTCGTCCCCCTCGTCGCTTCCTC
TTCAACGTCCTCGTACCCGGTCCTCTAATAGCCTGTCCATTGCTACTATTTGCAGTCCCCCCATCTGTCCTGGCCAGTGGAAAGTAATAATCAAACAACG
AGCGCCCCGTCCTTCCTGGACTGCTCTCTCCCCCTGCAAACGTCGCGCCATTCGAGCGCTCGCGGTCACTGCCCGTCACCTCATTGGCACTCGTGTCCCG
TCGTTTCTTGTCGCTCCCACGAGGGAGCAGCACTGGCTCGACTAGCGTCGATACGTCACTACTAGCCGAAAGAGTGACACTGCTCTCTTCCGGGTAGCTC
CTCGTGAGGCTTTGGATGCTGATTGGCTCCTGACGCGCGCTCCAGTCGTCGCGTGTCGCATGGACCTTCACGCGCTTGCTCTTGTTCGTACTTGAGCCGA
GTTTCCGCTCGCTGTCGCTCTCTTGCTCGTCAACGACCGCCATGAGCGACGCCATCTTCATCTTGGACGACGACGACGAGCGGGGCGCGCGGCTGCGACT
GCTCTCGGCGTCGGTCGATACGTAGGTATTAGAGACCGAAGAGGACGAGGCGGGAGTGGGGCGCGGGCGGGCGCGGCCTCGTCGACGCGGTGGGTCATGC
TTGGGATGATCCGGATCGTCCGCTCGGGCCATTGGGAAAACGGCCGACGAGCGCTTTTGGCTCGTGCGGTGCGAGGCGAATTGGAAACTGAGCGCTCACT
CGTTGAGGTGTGTGACTGACTGAGTGGGGAAGGCAAAAGGGTGGCGCGGGTGCGGGTTTCGTTTTTGGGGTCGGGAACGGGTTTTAGAGACGGGTTGGGA
GAGACCCGGGTGCGTGGATACTGCGAGGCGCGTGGGGGGTTGGGGTCGCTGCTGGTGCTGCTGCTGCTGCTGCTGCTTTTTTTTACAGGGACCGAGTATG
GTATAGTCAAGTCATGCTGAGAGGTGTGGGGGACTGTGTGCGATTCGGTGGTTTGTGATTAGGACGACTGTTTTACGACGACGACGATGGCTTTAAGTAC
GACTGCGACTATTTAAAAGCATGTGACTATTATGGGGACTGCGACTATGTAAGAGAATGCGCCTATTTAAAAGCATGTGACTATTATGGAGACTGCGACT
ATTTAAAAGCATGTGACTATTATGGGGACTGCGACTATGTAAGAGAATGCGACTATTACGATGACTACGGTAAATAGCAAACGACGACAGCGATAGTTAG
GACTGCTGCGATTGATAATAAGATGGCTGCTGTTGCTATGTTACACGTGACTCTGACTAACTGAGTCTTGAATTGCAGGGTTTATTGTCGGGCATTCCCC
ATGACAGTTCCTGGTTTATTTCTCTGCTTTATGACGATTACGTTCGCTCGAGTGACCTGCTGCGTAACTTCCTCATCCATGTAGTGAGTAGATTATTCGT
AGCTCAACTGTTGGCGGAAATTGGACTTTCAAACGGCGTGAAGGAAACTGCTGGTTTCCATGACGTTTTGCTCAGCTACTTTTGTTTGTATCAAATGCTT
GTCGCAAACATAATGCAAACGTCGAAATGCGTGCAGTGGTCCTTACAAGAGCACGTCAAATGACTTAAACACTCGTTCTGGAATCATTGTGCTACAGCCT
TTGAGCGACGCTTTTGGTGGTGTGCTAATGTCGAATAATGCAAAGGCTGTATGCAAAGCTTTGCTTCAGTTCAAGAGGGCAAATACTCACTCGCTCTTTT
CTCTAGATCCGTCCCCCTTTTTCGGTATTCTAGGTGGTGTGGTGATGATGTTGTTCGTAATTTAATTCTTACTGCGTGATGCCAGGAGTTTTCATTGCAC
GAACTAGTGTCGATCTTTATGCTCACAAACTGATATGCAGGCGAGCGATCTATGTGGAAAACTACTTCAAGCGCTCAGCAGCGTTTTCGCCACTCATTTC
GACGCAGACAGCTTTTTATCGTTAATGCGCTTTACCGCAGGAGGGAACCCAAATGCTACTGCAACAGAGCCTTGCGCCTTACGAGTTAAGGTTCAGTGCA
CGCACGTCACGGCGGTATCGGTGATCCGTGAGGATTGGAAAGCACGATCGCGGAGAAAGGTATTACGAACTTGAGCTATTATACGTCGCGCAGCATAGAG
AGGAGGTGTGGGGTCAAAACGCGCATAAGGGTAGCAGCAGCAGGATAGAGAGCAATCGATGGACACTCAACGGCATTGAAAACCAGTGAGTGTAATAAAA
TAGTAGCAACTAGCATGAGAGATGAAATGATATGTGCTCGAGATGGAACAGTTGTTAGTGGAGCTAAAATGAGTGGTGAGAACCCTGGTGTCGACGATAG
ATACATTTTTCGATTGAAGTGTAAAGAGAAAACGGCTACCGCTATTGTCTAATCGAAATGCGGCTGCATCGAACTAAGAAGAGAGCAGTGTTGTGATTCG
AACAGGGTTGACACAGCGGTATAGAGGGCAGAAAACGATGCGATGTGGATTGGTCTTGGGAACATTGATGCAAAGATGTGGCTGTACCGCTTACAGCAGG
ATTAGACGTCGAATAGAAAGGGCGAATCGCGAAAAGTTTGTAGGTTGACAATAGCTTTTGCGATGCTGTGTTAGACCTCAACTCTGGAGTAGACGGTGGT
AACAGCGAGCGTGTGAATCCATCCTTTCGTATATGCTTACGGCTTTGCTTTCTTGTTTTGCGCGTACTATCGAAGTGAATAAGCAGACATGTGAAAAGCG
CTCTGAAACTGATGCACTGAGATGTGTAATGAGTGATGGTTTTCTTCGCCTGCGGAAGCGCGTTATACTGTTGTTAGTCGATTGCTTAATTGTGAATTAC
ACCACACAATGAATATAATGTTGGATAGCTGGAGGCGGCAGCCCTTAGCTATCCAACACTGAGATCGCACATTCGGGATTTGCACGACTGAATGACGTAT
GCATTGTTAAAATGGGACGATCTCGTTCAGGACCCAGGAAGTCCTCAAGTGAGGCGCTTGAGCACGATGCGCGATGCCCCCTTGCTTCTCGAGTGCAAGT
GATTGACATCGTTTCCCATCCTTTCAGAGAGCGATGAAAAGTAGGCTTTTCGTTGTGCAAGCCCACTAGTTTTGGCAAGTGTGACTTGAATATCCAATTA
ATTCATAGCAGCGTTTTCAGCGACGTCCAATTCTCGCGGCAGCAGCAGCGAGGCTGATGAAACATCGGATTGCACAGTTCTCCAGCGTTCTAGCTCAATG
TATGACAGCTTTGGTAGGACTACAGGTGATGCGAACGAAGACGTCTTACGGTTTGTACCCCCCCTCCCATTTCGTATTCTTAGCACAAAATTGTCGTTGA
CCTTTGATACTCGATACTCTTCAGAATCGGCATTTAGTATCCAGCCAGAAGCCGTAAACCTGCATCTATATCAACAAACCATGGTTGAGGCCGAAGTACA
ATGACAACGAATTCGACCAGAGACTCTTCAGTTTCAGCTGAGCACTCATCTGGTTGTTGAATAAATGAAAGTCTGAATTCTTAACAAAACGAGTAGAGCC
ATCTCTTATTCTGGCCCAAAAACATAATCAGGAAGGAGGCAGGCCTCTGTTGTATCATGGTTTCGAAGGTACATATTAGCACGGCTTTGTCAATTCAGCC
GTCAGTTGAACAATAAATTAATGTTCCTTCCCATCCAGCAGCTTAGTTCAGCTGCAATAGTACTGAACACTTTTACAACAGCAGAAAGCTCTATCCGCCC
TACGGCCGAGCAACACCCTGAATTTCTATATTCAGATTCAATGACTCGGTCTGCGAGGTCTTGATAAAACCTTGCTAAATAAAGCGACGTGGAAAATAAC
TCGAGCACTTCTAGTGCCTCTGATTACAGAAAAAATAGTGCAAGGCAGTAACAGATAACACGTTTG