Description :
From Genome Similarity Track
Location :
Scaffold_28:24566- 26045
Transcript NameFunction/comments
Aphas_H257_10371class VII unconventional myosin

Sequence
1479 bases(100 bases per row)
ATCAAAGCATCATCATCAGCGGCGAAAGCGGCGCGGGCAAGACCGAAACCACCAAAGTGATCATGCAGTACCTGGCGCGCGTCACGACCAGTGGACACAC
AAACAACGGCGTCGTGTCGCTCGAGCAAAAGGTGCTCGACTCAAACCCGTTGCTCGAGTCGTTTGGGAACGCCAAGACGCTCCGCAACGACAACTCGAGT
CGGTTTGGCAAGTTCATTGAGATCCAATTCGACAAGCACGGCAAGATCGCCGGCGCCGAGATCATGAACTTTCTGCTCGAGAAGACGCGCATTGTCACAC
AAAGCCTCGACGAGCGCAACTACCACATCTTTTACCAACTGCTGGCCGGCGCCGACGACGCGCTCAAGCATCGCCTCCATCTCACCACGCCCCAAGACTA
CGAATACCTCAAGCACAGCGGATGCTTCTCGCTGCCTGCCAAGTACGTCCGCCCGTGCACCATGCATTGCTGCCATAGCTAACCGTGTACATAGGGACGA
CAAGGACGAGTTCAACATCACGACGCACTGCATGAGCACGATTGGAATCTCCCACGACATGCAAATGCACGTGTTTGAGATGCTGGTACAGTTAGTAGCT
ACTAGTAGATCATCCTACTATGACGACAACAACAGCACCAGTATGGTCATGCTATGAATTCGTATGTATATGTAGGCGGCAATTTTACATTTGGGAAATG
CCGACTTTGACGTGGTCGCCGAGCACTGCGTCCCCAGCAGCGCCGCGTCCACGGCGTGCCTCGAGCTGGTGGCGTCGCTGCTGCAGGTCCCCAACGACGC
GCTGCAGTCGGCTCTGTGCACGCGCCAGTTGTTTGTGGGCGGCAAGGTGATCGTGCAGGCCCAGAACGCCGCCCAGGCGCGGGACAAGCGGGACGCGCTG
GCCAAGACGATCTACTCGTCGCTGTTCATGTGGCTCGTGACCGAGCTCAACCGAACGATCTCGCAGCCGGCGCAAAAGTGGGGGTTCATCGGCGTGCTCG
ACATTTACGGGTTTGAAAAGTTCGACTGGAACACGTTCGAGCAGCTTTGCATCAACTTTGCCAACGAAAAGCTCCAGCGACACTTTAACCAGCACATGCT
CGAAGTAGAGCAGGACGAGTACACGCGGGAAGGCATCGACTGGGCGCATATTCGGTTCCAGGACAACCAAAGCACGCTGGAGCTTCTCGAGGGAAAGCCC
GGCGGCAAGCCCGGCGTGTTCATCGCGCTCGATGACGTGTGGCGCATCAAAGGCGACGAGGCCAACCGCAAGTTTGTCAGCTACCTGCACTCGACGTTTG
GCGTGACCCACCACGACTCGTACATCCAGCCCAAAGTCGACGCTGCGTTTGCATTTGGCATTCGCCACTATGCGGGCGACGTCATCTATGACGCTAGCGG
GTTCAACGACAAGAACAACGAAGACCTGAACGATGACATGAAGGACCTGATCAAACTCTCGACCAACTCGTGGCTGCCG