Description :
From Genome Similarity Track
Location :
Scaffold_40:245565- 247373
Transcript NameFunction/comments
Phyca_LT153437396ankyrin repeat protein

Sequence
1808 bases(100 bases per row)
ggcaagacacagcttgagccactgggctcgacaacaaggacacgccagctccactaggacgaaattcatctccgtcacttgagcgcaagtcgtgcagtaa
ttctccaaacccacggccataactgatgtcactagagaagatgtatgctcgaccctctcgttcgaataaccttcccaatgtagaatccacacatcggggc
cgtttggagaagtaaatcggcacaatcgtcttgcctttgtcttcagcaaacgctagctggtcactgaccagcttcgttttcatactccgttctgacaatg
ccacaaggaacactgaactctgcagaatagcgtcctttgcagctagaatccgctccttggtgctcgacacattggtcatcgaatcaaccacgaatggaaa
ctggtgacgtcgaagttcggtgcacaaactcgtcacaaagtcatcggatgacagtcgccatgcgaaacaaagatggagaacgtcggtcctcctccaaaag
tatttctccttccgctgccacgtacgatcacagcgttcacgatttcatccaaccgtcggcgactcagagttgcagccctccccaaaggctggtgtttgct
tagagatgtctgagccaggtctcggtcacctccaagccgatgaatctccacttcgtctcgtagtccatcgatgaggcttcgaagactagcctgcaacttg
tcctcatcgatttcaaactctacctgatctacaatcgacccttccgacactgtagagccgtcttcactggattctgctgtcttaaagtgatgcgacgtca
cggcttgacgaatgggacgatctgtcgggtgaaaacaaaaacctgtaactcctccgacattttgaccgattcgcaggatatcggaaccactggcacctcg
tgttgcttggcaaaagcgagctcatccatgcacaaagcactttgaacgtacccatcgctaagcatgcagacgatcgcagaggcatttttcatcacttcca
gagacttttcagacgcaccaccgccttctcttcccacactatcatcctcttcactgcgcatgtacactgtcatgaaattctgctcaatgccagctcgcat
cctctcggcaaatttgcgaaacaccggatggaaagagagcacaacgtcgacgcagccaccggcgactttcactgcgtactgcaactcagccgatgcacag
cactcgacagcacgtcgcccttctccattcagagagtacgtacaaatcggctttaccttgtacgagcaaggctagcgcagtttctttatatccaagtcgt
aacgcgatgtgcagaggggtctcttctacctcattgggaacgatggcatcaacatccgctccaaagcggacaaaaagctctatacagtcacctcgcaaca
ggccgccatccactgcaaacgccaatggtgtcagtccgtcataatccagttgcaagtaatctgcatccacagcaagaagcttctcaactgctccagcata
gttatgacgggctgcccagtgcaaaggtgtgcgtccatgactgtccttcgcattgacgtcagcaccgcgtttaaccagttcactaatcactcggtgcctt
cccattacggcggcccagtgtagaggtgtcctgctattcgctccacgttgaaattcgccaagaatgtcggcgctgataccccatgacagtaaatgttgca
cagttgcaaggttcccagcagccgcagcctcgtggagtggagtcggcgcaacatcggcgccccattcttccagcacagtagctaattcacgacgaccaga
gagctgtg