Description :
From Genome Similarity Track
Location :
Scaffold_3:2454564- 2457840
Transcript NameFunction/comments
Phyin_T30-4PITG_02531Putative uncharacterized protein

Sequence
3276 bases(100 bases per row)
AATTGTGGATGCTGGCGTCGGGAGCTCAATTGGAAATGAGGAAAAGCGAGGGCCAGTACGAGCGATTATTAGCTTCAGAGTCAGAGAGCACGGAGGCGAC
ACGGCAGATTGATGTGGATCTGCATCGGACTGTTGCGAACGAGGATAAAGAGCTGTGGACCGAGGAGAAATCGAGGATGATGCGGCGTGTATTAGTCGCG
TATTCCATCTACAACCCGGGTTTGGGATACTGTCAGGGCTTAAATTATATTGTGGCTCGAAGTCTGCAATATCTGGGCGAAGAAGAAGCGTTCTACTTGC
TCGTTGTGATCGTTCGGCTTGTCCCTGATGATTATTATACGACAATGGTGAGAGGATCAGCTTGCTAAAGTGCTGGCTTAATTGAGATCTAACGGTTAAG
TTCTGTTGCAGCTGGGGCTGGCTGTGGATCAACACGTGTTTGCCGATCTCGTGCGGCTTCAGTACCCGGAGATCTCGGAGCATCTGTCGGAGCTTGGTGG
CTCAGGGATGGAGCTTTCGCTTGCTTGTACAGAGTGGTTCTTGACCCTTTTCGCTAGTCCTTGCGAAAGAGGAGTCACTTTTCAGATCTGGGATGCCATT
TTTCTTCAAGGCGACGAGGTAAATATTTGCTTCTGAGCGGAAAGATGTGCTCCGGCAACTAATTGGGAGGCTTGTGGCTGTGTAGGTTCTCTTTAGGGTA
GCGTTGGCTCTGCTTCAACCGGCAAAGACTGCGCTTCTCGCGTGCAATAATTATGGAGACATGCTGAAGCATCTGAATGAGGTGCGTCTACAACGATCTG
GATCTCATTAGCTCATTAGTAGCTGGCCACTGACGTCATTTGTGGTATCTTTTCAGCTCGGAAGAGGTGAACTAGACGCTCTAGAGTTGATGCAGGTCTC
TAAAAACCAGGACTGTGTGATTCGTGGCCGGATCGAAGACTTTCGAGCTCATCATCGCCTGCAACTGGCATCGGGTATCGTCGCATCCACTGTTGAAGCT
GAGGATGCACGAACCTCATCAACAGGACGGCGAAGTTCAGAGGTTAGATCAGAGCCAAGACTGAGGATATTTGGCCGCAAGAAGCCAGGCATTTTCCGAC
ACATTGACAGGATCCCTCCTCGCTTAGCGCGGTATGCAAAGTCAACCGGGAAGCCTGAAGTGAAGGTAACCTTACACGTTTTATATGCTTTTGCAGAACA
TTCGACCGAAAGCTCACCGAGGATTACATGGAGACCATTCGACAAGATCATCCCAACTTCGCGCAATATTACGAAGGATTGCAGCCCCAGGTGCGTGCAA
TGCTAGGACGCTGCCCTGATCGATGAAAATTTTTCTGTCTTACACTTCTGCCTGATCGTTACAGATTATAGAAATGTATTGGGGATCAGCAGATAGTTAT
CGTCAGTGGGGAGCACGAAATGTTCGTCGAATTTCAACCGATGGGTTTGCTGTCAGTAGCTCCAAAGACAGTGAAGGCCACCACGTGAAAGAGGAAATTA
ACATTATGGGAGATCATCAGATGAGTCCGAACGTATCAGGTGAACGGAGACGTGAACTGACACGAGATCGTCGCAGCAAGAGCTTCATGCACCCGAAGAA
GGTCCAACACAACAGCGCAAACAGCACCCCTAGTAGCCGAGCGGTCAAAGACAGCGACGAAGATGCCCAGTTGATTGGACGCTCCCCGTTGGCATGGATT
CAGCGGTTTGAGGAATGGCATAAAGACTTAAAGACCCAAAAAGAGAAGAAGAAAGCGGAGAAGCGACTGCGCCGTAACCAGCGCTCTGAAAGCTTATTCC
CTGGCTCCAGACACGGACAACCGGATCCTTGGATGCGTGGTGCCACTGACTCGTCTTCAGTGCCAATTTATCCCCAGCCGAAGCAATCGCAGGATATTGA
AGGATTTTCATTAGGCCACAGAAGGAGATCTAACGAGTACCAGGGTCCATCCCCCGAGAACATCCCGATGCTGGAAGAACCTTCGCTTTCGCGCTCGTAT
TCGGACCCATTTCGATCCCCCGCGGGTATTGCGGCACATAGTCTGCGTAAACACGCAAGTGAAAAAACGTGTCGCGAGAGTGAACAGTGCCCCATGCTGC
CACAGCATCCGCTCACAAAGCGCAACATCGATCAAGTTCCCCAAAAAGCAGATGTCGATGAAGTACGGAAACTCGGTGGAAGTAGCAATGGACGAGCATC
TCGTGGGTTCAGTGACCAGAGCACGTTGTCGAGGAGCACCAATTCGTATGTCAACACAGCGTCTTTCACTCTGGACCCACAGGAAGAAATCCAAGATGAA
TCAAACTCGGACGCTTCACTCGACGAGAAGAACGCAAAGCTACATGTAGACGATGAAGGACTGAGCCCCACATTGGCACAACTGGAGAAGCCTCTGGCGC
ATGAAGTCATGTTCTCTCCGTTTCATTGCCGATCGACCTCTATGGACTTTGCAGCTGCACTACAGCACGAAGAGCCCGGATCGTGTGCGCCGCCTCAGAT
CCGCCGAATTCTGTCAGTTCCTGCTGATGAAATGAGCATTCTAAAGCGACCGCGGCACCCCAAACGCGACTGTTCTCAAGCGATGCGAGAGCGTGCAAAT
GTTCTGCAGTACATGCACCGGAAGGCAAGCGACGCGAGTAGTATCGCTGGCAGCATTCCACGCAGTCCTGCACGCATGAGCGAGAGCTCCAGTGATTCGT
CTCGCTTCGGCGACCACACCAGCAATCGAAGTGGCAAGTCGATGCACTATCGGAAAAGCTCGTTCTCGTTTTTTGACAAGCTTTCAAGTGACCTGGAGAA
CAGTACTCATGGACTGGACAGTCTGGTGGACGAGTCTGAATTCAACACTGACGGGATCGGTCGAGGATCCATGTCTTCGGTTGCGACCGGTCGCTCGAGC
ACAGTTGACGAGCAACGACCTATGGGTGGAGCTATCTCCATCTCGTCGTGAACAAAATGAAATGACGAAAAAGACAAACGTGAGGAATTTGCAAGAGGAA
AAAATGCCAACGCTAAGCGATTGGTTTGATGGAAGTGAAGTTAGGTGTCGTCTAATAGAGCTAAAAATTGATGACAGATTTTATCTTGGCTTTTGTAAGG
TTAGATTTTTTGCATTTGAATAATTTGGCTCAAAGTGAAAAGTGAAAATGGGCAAAGCGTACGATGGCAAGAAGCGGTGGAATGAGACTATCCTGGCGAC
GACAGCGCGGGCCTCCGCTGCCGGCGGACGGCAGACCGCTACGAAAAAGCGTCTTTCGGGTACGGCTATGCTTTAT