Description :
From Genome Similarity Track
Location :
Scaffold_3:24543- 26574
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01232PREDICTED: myosin-IXa
Sappa_CBS223.65SPRG_01233Hypothetical protein

Sequence
2031 bases(100 bases per row)
TTCCCATCAATTCCGCGGCAGAGGCCGACGTCACACCGTCTCTCAACCCACTCGATATAGCGACTGCCGCCAACGAAGTCGTCCCCGTTGCTTTCGACAT
AGAGCTGCCAACCGGCCTGGCGGTTCCTGCGCCGTCCTTGGCGTCTGAAGAAGCCACTGCGTACTACATGAGCGACGAGTTTGATGACGTGGCGCCACCA
GCAGTCAGCCTGACGCCCTCACTGCCGTCGTTGCTGTCGCCACGTGCGCTGCAGCTCACGTACTTTGTCGAGTGGATGACCAACAGCCTCCGGTGCGTCC
AGTTCCGAAGCATTCAGACGCGGGCGCTTCGACACCGGCGACTCGATGCGTTTCGCGCGTGGGAGGCGACGACCGACGGCTGGCGCCGGCGCCGCGACGC
CTTTCATGCGTGGGCCGACGTCGCGTCGGCCGAGGCGACCAAGCGCGCGCAGCTCCGCATCGAGTTCGCGCAGGACGCCAAGGCGTGGAAGAAGCTGCGA
TCTGGCGTGCGGCACCAGCGCTGGACCAAAGCGATCGAGGGCGGGCGGCAGCATGGCGAGTCATAACACTCAACACGCGCGCCGTTTAGAGTCTTTTTGT
TTTACGAACGTGTCCAGCGACGGATCATGCACTCTGGAGGCGTCGGCCGAGCGGCGGCTTCTCGAGGCCACTGCGCACGGCGAGCTTCCCGTCGGGAAAC
CGGTGCTCGTAGAAGCAGTCGTGTTTAAACGGACATTTGCCCCTAGATATTGGTGAATTGCCGGCAAATGGGCGAAAAGGAGCGCACCGGCCGAGGTTGA
AGTGGCGGCAAGGGATCGTCGCGAGGTTGGCCTACGCGATCGTTGAATAGAAGCGCTGCGGAAGGAGTTGGGACCTTGTAGTCGGCGAGGATTTTCTGTT
TCCGCGTCGGGTCCGCGATGAACCGGTTGCAGGGGACGATGAACGGCGCGTCGGCGGCGCAGACGGGGCATTGCCGGAGCTACAGCTCCATGAGACGTGG
ACTAAGATCTCTCTCTCTGGGTTACCACGTCTCGGTCCTTGTCCCGGATGCACTTGAGGCAGAAGGCGTGGACGCAGTTGGGCAGCAGGCCAAAGCGCTC
GCCGGCGCGGAGGACGAGGTCCATGCAGATGTTGCACTCGACATCTTGTGACGCATGCAGCTCCTACACGGTGAGGATGAGAAGGCGAGTAGACGCGGCG
AGTAGTACCTTGTCCATGAGCATGCCTTCGTCCGGCGAGAGGCCCCGCGCGTGCGAGTAGATGCAGGCGTCGCCAAAGCGGCAGGCGCCTTGCAGATGGA
ACTTGCATTGCTTCCTACAAAGAGGTTGACGCGAACGATGGAGGTGACAGTAGCACGCACGGTGGTGCGGCCGGCTGGATGTCCGAGTAGTCGCAGTGCT
CGATGGACGGTCGATGCAGGATGAGGCTCGAGTCGGTCTCGTCGCCGTCGTCGGTGAGCGCGGCCATCTTGCGCGCGAGGTCGTCGAGCTGCTCCTGGAA
CTGGTTGCGCGCCGAAACGAATGTGTCGTACTCGGTCGGGCCGTCAATCGAGTCGGGCTCAACGTACGAGTAGTCGGTCTCCTCGTCGTAGTCGCGGCGG
GTGAAGCTCGGGACGTCGGCAGGGTCGAGGATCTCGACCTCGAACGCATGGCCATTGATTTGACCCGTCATGATCCGGTTCGAGTCCGACTTGGGCTGCG
ACACGATGCTGCTCGACTGGTGAGGCTGCGACTGGACGCTTGACTGATTGTGCTGCGACTTGACGCTCGACGGATTGGGCGCCGAGTTGTCGGTGCGCTG
GTCCATTGGCAGCGAGCACGCGATGATGGACGGCTCGGACCCGGCGCTACTGTGGGCGAAGCGGCAGGCGGCGCCCATGGAGCACTTGCCGTCGCGGAAG
AACTTGCATGGCGGCCGCGCCGGGTGCTCGAAGCGGCAGGACGACCCCTTGCTGCACGCGTTCTGGAGGTGGAAGGTGCACACGGCTCGTTTAGTCGACC
CACTCATCCAACTACGATCCGACCGTAGTAC