Description :
From Genome Similarity Track
Location :
Scaffold_21:245422- 247452
Sequence
2030 bases(100 bases per row)
CCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCTGTCACGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACT
GTTCCGCTGTTGCAACCGAAGCGCACGAGAGTGCGCTTCTATCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACT
TATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACCCTTGATCTTCATACGTGAAGCGCTCGTGTACCATGCGCTTCTCGGTCTTCACGACGGCACC
CGTTGCCAGTCGTACCTCCAACATACTTTGAGTTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCA
GAAACTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAA
TCTCACTGGGGACTGCAGTCCTCAGTGTCGCGTGTCGAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCACCGCGCCTACTCGCGTCCAGCGTTT
TTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCAGAGCAAACTGACCGACTCTACCGCAAC
GGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGACCAGCGGTTGCAGCACTCGAGAGGTCCATGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGG
CCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAG
AGATAGGTCTTCACAGGTCCATCTCTCAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGCGATCGGATTGGTCACGAGGTTCGAGACCAAGTAACG
TGCTCTCGGAGCGTAAGCATGAACATCATACTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCAAACGCTCGT
CTGAGCTCATCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGCCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACA
TGGCGAACGCAACCTTCGAGAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGTTCACCCTCTCTTCC
GACATAGTTACTCACATTGAGCTTCGGCGATAGCGCGCGTGGTGTCGTCCCGGACGGCACCGCGGTAGTAGCAGCAACCTCCCGTTGCTCCTTCAGGATG
AAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCCT
CCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATATCCAAGGGAAGGTTCTCAGCTCCGCG
TTCGTGTGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGACCTACTTTGGCGTACTACTTTAACTTAT
ACGTGTGTGCACGTGTGTGGGGAACCGTACCTTAGTTTAAACTAGTTAATTATACTCGGGCCTCCAAGTATAGATTAATCTAAATAAACGATCCAAATAC
TATTTGGGTTAAAATGCTGCTATTTTTGTTTTATGCTTTCTCACTTCCTCTAAATGTAATATTCTAAGTTAGGAATCTGCCAACGGCTGGTTGGCAGAAT
TCCAACGCTAGGAATGTCGCCCATTGGCTAAAAGATGCTTTTTTCAGCCAATAGGAATCGTAAGTCTCTATGGACCACCCGTCGTGGTGATCGTAAATGC
ATGTAGTCTTTGGTGTGTCTACACCAAGGT