Description :
From Genome Similarity Track
Location :
Scaffold_14:245416- 251964
Transcript NameFunction/comments
Physo_131051reverse transcriptase
Physo_131052reverse transcriptase

Sequence
6548 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTGTGCAGTGCATGGTGGACTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACTGGTTGCCTGTTCGCTCTCGGGATACTGTGATC
AACAATCCGCTCAACAATCCATCGAGTTGAGCCGTGTGCATCACGAATCGGCGGCGGCGGTGGTGGAAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCGCTGGGTTCGGCGCTTTGAAGTATCCTCAGGTTGCGGCAGCCTCC
CAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCGCTGGAGAGGATGACGGCTTCCGCCGAGTCTT
CTGCTTCAGTTCAGCCGAGCTAGGTAGCTCGTACTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGAGGCGCATACTAGACGGTATGTCC
AGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGCCCGATGAAGCGCGGAGCAAGCTTGCTTGCCCCGAAGTCGGAAACGGCATGTTTAGGCA
AGTTTTGAGTAGCTAACAAGACTAATGAACCCTTCTTGAATTCATTTGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAGC
TGCAATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGAT
CCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTTTTTTTGCTCTTGTCGGCGTCTGTGTCCTGCACAGACGCGT
GCTTCTTGGTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCTAGTGTCAGCGGCATTCTGCGGCTGCTGTGTTGCAGTCGTAGATCCTCCCCCACTTAA
GGAAGGAGCCACCATCCCGAGTAGACTGGGGAGGCGTGGGTGCCTGATGGCATTCATGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTG
ATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCT
GCCCGTCCGTCTGCGGATGATCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCG
ATACGATACAATGTCGGTCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCGCAGCA
AGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACT
GCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAATCTCGCAAGCACGGACGTACTTGCG
CACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTAAAACTTG
TACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACACGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGT
AACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGCAGGCCAGCAAGAGCTTCGCGCCCGCGTCGTG
CGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTCGGGGTGCTCGATTGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTGA
GGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCC
GTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTTGGAACTTCGC
GAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTGCCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGGCGCGATTGGTAGTAGACGACACGATCACGA
CCCTCGTGATCGTGCTGCATCAACGCACATCCAATTGCGAAGTCGGATGCGTCACACACAACGTGGAACGGGCGATCTTGGTCGCCCACCGCCAAGATCG
GCGCCTCACTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACGCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGCGGGCG
TATCATGCCCGCGTAGTCCTTCACGTACATGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGACGTCGGCCACTCATTG
ATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGT
TCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACTTTGTGCATTTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGAC
GAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGC
GGCATCACTAGCCGCTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGACATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCA
GATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTT
GTTATACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTG
CGACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCT
CGTGCTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGGTCTCGTAGTAGGGACTCGTTTTCAA
CGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCT
TCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAACTCATGACTG
GAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGGGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTC
GACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGGCATTCCTTGTAGCGTCTCGACCCCAGGCCGAGACTTGCGCAGCGATCTTCGCATGCGCCGTCTT
CTTGTTTTGTGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCC
GCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTCCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCA
ACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCG
GCTCCCCGAGCCGACGAATCATATTCGCCCAAGCCATCGACTCCCGGAGTCGACGGCGTTATGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAA
TCAGATTCGCGTCAGCCTACACGGCTGAGGCGTCTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGT
GTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGCGAGCTCGCGCGCGCCCAGGTCGTTCC
GGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGC
GACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGTCGTGCAAGCCACGACATGCCCAATACAATGTCAAACTTATCGTCCAGATC
CAGGACGATAAAGGTCTCGACAAACGCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGT
ACTTCCAACATACTTCGAGGTATCTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTAGACGCGCCAGAATCTACCAAAGC
ACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACTTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATCAACCTCACTGGGGGCT
GCCGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGAGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCG
ACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCATGGGGGTCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACA
TTGTTTCCTTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGCGCGTGGCTGTGGCCTCG
GCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATA
GGTCTTCACAGGCCCATCTCTCAGCCCCTTTATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACTGTGCT
CTCTGCGCGTATCCATGGACATCATGCTTACCCTGCTGTAGGTTGAGAAACTCTGCCCTCGACCGAAACTCATTTTGCGGGGGCTCAAACGCTTGTCTGA
GTTCCTCCTTGAAACCCTCATAGGTGCTGAAGCACATAGGATCAGAGAGTCGGCGTCCATACGCGCAACTTCTCGCTCGTCCGCCAAGACATGACATGGC
GAACGCAACCTTGGACAACGGGTCGACGATACGTCGAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACA
TAGTTGCTCACGTTTAGCTTCAACGTTTGCTCGCGCGGTGTCGTCCCTGACGCCACCGTGATAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAATC
CCAGAGCAACACCGTGTTGCTCCATCGGCGATAGTGTGCGCAGCATTACAGCTACAGCCGCTTCTCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCA
CTCTGGATCCGACAGGTGGAGGCAGTTAGCGCGTGCAACATGAGTTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCG
GCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACCTTGGCTCACTAC
TACGGCTTACACGTATGCGCATGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAA
GACTCCAAATAGCGTGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCA
ACGGCTGGTTGGCAGAATTCCAATGCTATGCATGCCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCCCTATGGACCACCCGT
CGTGGTGGTCCTAAATGTATGCAGCCTTTGGTGTGTCTACACCAAGGT