Description :
From Genome Similarity Track
Location :
scaffold_103:24540- 27015
Transcript NameFunction/comments
g13050.t1 hypothetical protein PHYSODRAFT_339765

Sequence
2475 bases(100 bases per row)
AGACAGAGCTGCTCGTTCTCCGTCAGCGGGTGGTTAAGTCCGAGGGCGTCTTGAGACTCGAGGGGCTGTCCTTGAGGCCGCCGATGGGGAAGCCCTCACT
CGACATTGGCATAGCGCTCCTTCTATTTGAGTTTTAATTTACTGTGGCTGTAGTGAGACGTGACTGGGTGTCATTCGTCTTGGGGTATTGCTGGTTTTGT
GCCTGCGGCGATGAAGCTGCTATACTGTTTCTGACATGGTTGCTGGGGATTGTCGCCCCGCCTGTGCTCTGGGTGTTGTAGATGGTCGTTGTACTTGTTT
ATGCCATGAGTTGTGCTGCTTGCGTCTCCCTCTCTGTTGTGATTTTCCCCTCGAAGATGGCGTCATTGCGAAGTCTCCACAGTAAAACTGGAGTGACTGT
CGCCCAAATTCTCCATTGGAGCCTCATTGCTCCCGTGTGGTGAGGAGTCCATCGTCTCATACCTTATTGTTTTTTTTCTTCTAAGAAAGCTGTCTGAATC
TGCCTGCTGTTCGTAGTTCGTCTTTCTGGTCCGAAGTAGTTTGTTTCGGTAGTGGAGATTTGGAGCAAGCGGTAAAGATCGCCTGATTTAAAGTTTGGCC
GTGCGATGGGTGCATTGCGGTACGTGCGGGGCCAAAATGGAGTTGGTGGAAGTGCAACACAAGATGGTGGTAAGGTGGTCCTCTATTTGATGTTTATATG
TGTGTGTGTTTTCCCCTATAGAAGCCTTATAATATGCAAGACGTGACTTGATGTCATTCGTCTGGCGTGGAGGAGATTGTCGTTGGCCATGGGGAGTGAA
TCAGCATAGGTAGGTATGAGTGGGTCTTGCACAGCTTGTAGTGGGTTCGTAAAATGAATGTTCTTGTCTGTTTGGTGTTCACGAGTATGCGGGCTGCTTC
AAGACTTGCTTTCGCTGGGGTGCTCCATTTAACTGTGAACAAGCGTTGTAGCGTTTGATCCAGTTCGTGAGCGTGGGTGTCTCCAGTTGTGGTTTTTGTT
GCTGGTTTGATCGCTTTCTGCGCTGTTTTATCTACGCTCGCAAGGCGTAGATATGTGTTTGCTGCGTCGTCGTGCTGTTCTGCTGCTTGTAAACCGATTG
GAAGTGCAAGACGAAAGGCAATGAGTTTGATGATTGAGTATTCACCGCGCGGGCCATTTGAGTCCGGATCGATTTCCAACGCGTACCCAAGGCTCGTCTG
TATTGTATTCCCGTCCACTTGCCCTTCAACAAGATCCTTGAAATGGCTACAGTTTCCACTTGCAGAACGACTCCTCGCCTCACTTTCGTTTTTGCCTCTC
GTGCTCCAACAAGCCCCCACTGGTCAAGATGGCAGACGCTGCTACGGCCCCCCCAAGCTTCCCCGTGACGACGATTCCGGGCTCACCATCGAGTCGCCAG
GTGCTAGCCGCTTGCCCCCCAAGGTTCGCGCGCAAACCTGAGTGCAGCGTCTATTTCGAAGGCTTCCTCAATCGACTCAACGCTTGCCACGACGCCGTTG
AAGTGCATGACGACGAGTGGAAGAACAAATACTGTAAGCTCCTCAGAAGGTTCATGAAGCTCCTACGCCAACAACCTTTGCTGGAGCGTCTCGCTGGGGC
CGACACGATCGCCTACACGTTTCGAGAGCTCAACTCGAGGCTGGACGCCATCTGCGTGGGTATTGAGTATGCTACAACAGACCAATGGATGGCCGATTGG
AGTCATGGGTGTGAGGTTCAGGCCCAACAACTCGAGTCCCTGGTCACGGGGACTGCTGCTCGCATGCTGATCCGAGATATGGGCAGCGAGAGGAAGGTGA
CGACGGCAATGCTGGAGATGTACACGTCGCTGGAAGAAAACACTCCAGGACCCCTCGCAGATCTCAAGCGGGCGACGTTGGAGCGCCTGCGAGTCGCTCT
TGACCTCGAGGCTCGTGTTATCACCTCAGAAACGGTGGCCGGCATTGATGGACAGCCATCGAAGATTCTGTCCATCTTCCGGTGGTTCATTCCTGAGAGA
GACGTGGACGTCATGGAAGGTGGGCCCATTGGAGCTGGAACCTACGGCACCGTCAATTTTGGCATATGGCGCCGTCGTGACGGAACCACCCAGGACGTCG
TTGTCAAGTCACTGTTTGATCGAAGTATCGACTCAGAGCTGTCGTTTCTGAGGCAGCTGCAGTTTTGGTTCGAGCTCCCAAAACACCCAAACATCATCCA
ACTTCACGGCGGCTGCCATCGTGCTAGACAGCCGTTCTTTGTGTGTGAAAATGCTCCTGGTGGCAACATCTCTCAGTTCTTCGGCAAACCGGAGAACCAA
GATATGTTCTGGAGCATGTTTCTGCAAGTGGCGCAAGGTCTTCAGGTTCTCCATGAGCACCACATCGTTCACGACGGCCTTCAGAGCGGGAATATCTTGA
TCGGAGACAACAACACCCCGAAAATCTCGGATTTTGACTGTTCTCGCGTCAGAACCATCTCTGCGGGCTACAGTA