Description :
From Genome Similarity Track
Location :
Scaffold_22:245343- 249586
Sequence
4243 bases(100 bases per row)
TTTATCCATTTCATGCTCGGACGAGCTCTGACTAAGATCAACGACAAGTTTGATTTCATGGTCATGCTTGTTGGAGTTGGCGGTTTTGGCAAGAGTTTGC
TGCTTAATTTGATTTCCTATGCATTCGGCCCTGATCAAGTAGGAACCCTGGGAAACAGTTTTCAGGACAAGTTTGGGTTATCCGAGTTAGCTGACAGGCA
GATTGTGCTATCCGAAGACATGCCTCGCAACATCGCTAAGACGCTACCCAAATCCGATTTCCTGTCAATGCAGAGTCGTGGTCGTATTTCATGTCCTGTC
AAGGGCAAGACCTCTATCGAGGTTGACTCGTGGGATATCCCCACTCTTATCAATAGCAACGACCTTCCCAATTATTCCGACACCTCTGGTGAGATTGTAC
GTCGTATCCTGATCCCACACTTCACCAATGTCATCCCTGATGAAGAAAAGGACAATCAGCTTGAAAAGAAAATCAAAGCGTCTGAGTTTGCAACATTCAT
TCACAAGTGTCGGTCGACGTATTTGAGATTCTGCAAAGAGCATGCTGGTCAGAATGTCTATACATTTGCTCCTCAGCACTTCATTGACAGCCGAGACATG
CTTCGCGGTTAAATCAACGAGAGCTATCAATTTTCTAAGGCTCACATCCAATATGTTGAGCCAGTCAAGGGGCAAGAGCCATGCAAGATCCCTAAGGCTG
ACCTCACAAGAATGTTTCGAGCATACGTCAAGGAGAAATACAGCATGTCCAAGTCGCCTAAGCAGGCCATGGACGTTCATTCAGTGGTTAGCGCTGATCC
TCGTATCAAATTCGTTGCTGAAAACATTTGCAAGTCATGCCGCAAGAAGCATACTGCGAACTGCTGTAGTGAGTACTCGCGCGGCAACCGATCCAAGGCT
GAGTACATCATTAATGCCAGATACTCGCCAAACCAAATTGGTGAGTGATGATTAGACATCGTCCACTTGATTGTATGTATATTTTTTATCTCTGAACCCA
ATCAGCTAATTTATTTTCTATTTAGAGGTTGGTGAGTGATGATTAGACATCGTCCACTTGATTGTATGTATATTTTTTATCTCTGAACCCAATCAGCTAA
TTTATTTTCTATTTAGAGGTTTGTCTCTATATTATATATTCCTGTCCGACTTACCATGCTCACCCGCGACGACTTCATCCAATTCTCAGCACCGGCAAGC
GCGTCGCTGCGTCGACCCTCAAGAACAGAGTTAATTTTCTATTCAAGCAGTATCGCGACATCGGTGGAAACGCCAATGACCTCTCATATCTGAACAGCTA
CTCGAATGTCATTCGCCACATCAACGAGAGCAAGAACGCTGAAGGAAAGAAAACATACCTGTTTCACCCTCTAGCGCTCGCTAATACGAAGGCCGCTCGA
CATGTCGTCAGTGATGATGCGAGGCAGAAGCTTCAGTCAGCAGCTAACCGCGCTCGGGACAAATCCAAGAAGGACTCTCTGAACAATGTCGCAACCGACA
AGCAGCAGCTAACCGCGCTCGGGACAAATCCAAGAAGGACTCTCTGAACAATGTCGCAACCGACAAGCAGCAGATCAACTATCTCAGCATCGATGGAATG
ACTATGCAGCTTGAGAAGCACATTCACGAGTTATTCGCTAGCTATGATATGTCTCACAAGGCCGCCAAGATCAGTGATGCCGACTTTGCCAGATGGGACA
TCCAGAGCGATCGTAAGAACATCAAGAGCTTCGCCCGCGATCTCCAGCGATGCATGATGCTCGCCTGCTACGTATATCAACCTGCTCTACGCGCTGATTG
GTGTACGCTGAAGATCACCTCAGCCGCTGTCAATCGACTAGATCCAAAGCTCAACTGGATCCAAGTACTTCGCGGAGGTCGTATCCGATTGCATATGAAC
GATTTCAAGAACCGTAAGACCTTCGGGGCTCATATCGTCGAGATTGAAAACATTCACCTCAAGCGTTATCTCAAGTACTGGATTGATCTGCTCGGAAGAC
TGCTCGGATCGAAGCCTGAGCATCTGTTCATATATCAGCTCAGCCCTGTCAAGGATGTATCGCTGATCAGTACTAATAGAGATGCATTCCCGAAGGCTGT
TTCTCGAAACAGTGAGAAGGTCTTCAACAGACCTCAGACGATCAATAGCTTCAGGCATGCTTGGGAGAAGAAGATTCAGGAGGATCCAGCCTATCAGCGC
ATGACTCAAGCTGAGCGCCAGGAGCTACACCACAAGCTTCTCCATGGTGTATTTACTGGCCAACTGTATAACTGGCAGCGGCGAGGATACTCTGACTAAG
CAAAAAATATTTTTTTAGATTGTAAGGCTCTTGAAGTTCCATTTGGTATCCAGAATCGGTTCTACTTTCTCGAACTCGCTTGTCAGCAATCGTTTGAGCT
CGGATCTGGCGATCATGACTCTTTTGCGAGATCAGCAATTTTTTGTGATTCAACCTCGGCATCCTCTTTGATACGGTATTGTCATAGACTCCGGATGTAT
CTAGATCTTCTGAATCGATATATTCAATTTCGTCCTCCATCGTAAATTTATGTGATTGAGTATATATATACGATTGCGATAAAATTACGATGACTTCATG
CCGAGCACTCACTAAAAGCGACACCCCATGCTCTCGCAATGCTCTTAAAATCGGATACAGTGCTCAGCACGACAAGGATGCTAAGATTAGAATGTACCGC
AAGGAGCTATCAAAGATGCACGAGCGCGTTCGTCGATATTTGGAGATCACTAACGAACTCAACGATAAGCTCTCGATCATCCAAAAAGTTGATTTCTAAC
AAGTCTGAATTGATGAAGATCGGAAGCCATGATAGACCATACAGAGGAATCATAGATAGCTCGTTCTACAAGGCCGAAATTGAAGATTTATTTGGCATGA
AAGCTTCTGCTGCTCATGATGAGTATGATAGACTGCTTGCGTTACGGAATCAATTGGTCCATCCACATACACTAGATGGCAGAAACGGCTCTAGGACGGG
GGCTTTGCCCCGCGTCAAAAATATGGGTTTGCGAAAACGATATCAGGTAGACTATAAAAGAACGATGTTTCCATCATTCAATAGCCTATCTGAGCGAGAG
CGCAAGCGCCAGGAGCTACTGCGCGAGGCTGAACGCGAGCTCGCTATCGATAGGCATCTATCGCATAGATATGCGGAGACCTTGTGGGCAGCCGATAATG
AAGCGATTACTATCCCTCTAGCCAGAACTACTTATGGAGTCAGCACGCAAACCGATGGTACGCAAGCAGCATCTACCACTACGACGTCGACCGACACGAC
ACCACCAAGCGAACTAACTGGAGATATTAGCATTCCAGCAACTGTATCATCTACAGCTGCCTCAGATATGGTTAATCTAGATACTGATCATATCATGTAT
CGTCCCGATGCGTCGATGGAGGAGGCTGTGTCCAAACGCGAGGATAGACAAGCAAAATCATATCAGGCTGTTGTTGAGCTATTAACTAACATGCCGGATG
TTGCTACATGGGATCTCCATCCGCTCTTCGATCCGATGCTAGTCAAGGACGGCAATGCAAAATCTCAGCGTGATTTGTTCTTCCTCGGACCAGGTGCTAA
GCTATACCATCGTAGCTCTCGGCAAGCTGTACGTAAGGACAAACAGGAGGATTTGATTGAGCAAATCGACTGGGAAGCTACACTCGAGTACATCCTTGAT
CGTATAAGATTAGTTGATGGCTATGTCAAAGCGCGAGATCTACGGGAAAAGCTAGATACTCAGCGTAAGGTATTCGATGGGCTCAAGCTCAATGCGGATA
TGCCAAGATTATTTGAGAGCTTTAAAGCGCTCAACTCAATCAAGGATGAGATTGTGCGAGAGGACAAGCTTGATAGTAATCGATTGGGAGAGTCTCGCTT
AGCATTGAACGACATGGTGAATCAGATAGTCAATGAGAATCTATCGAGGGTTCGCGAAGCGATGATATCAATCGCGATTCGAAACAGATCTTTACCCAGA
TCGTGAATAGCAATTGGAATGTTATCAAAGCTAATTTATTGCATGATTTCAATGACAAACAAGGTTTCTATGCGCTGGGTCGTAGCGACGATCTGCAAGG
ATTGCCTCCTCCAATCGATGGATACTACATCGATCCAATCAATTTTAAGGTTCGTCAAACACGTAATCATCGAGTATCGAATAATATGGAGAAGGAGCGT
CTGTCATGGGCCAATACACTTCAATTCCTATTCCAATCGGCTC