Description :
From Genome Similarity Track
Location :
scaffold_1302:2453- 3609
Transcript NameFunction/comments
Pl_100890HECT E3 ubiquitin ligase, putative

Sequence
1156 bases(100 bases per row)
CTATGGAGCACCTAGGATGTATAGATGAACAGTACGTTCGCTCGGCCATGCGCATCAATTTCCTTGAGGAAAGCGGCGTAGATGCAGGTGGATTACATCG
CGAGTGGTTCATGATGCTCACGGAGCTACTGACGGATCCGAAAGCGGGGTTATTCAAAACCACGCATGGAGAGGACCGTGCGTTCTTCCTGAACTCAAAT
TCCCGCTACGAAAATGGTGAGGAGCACCTTATTTACTTTTATGGAGCAGGACGGCTACTGGGGCGGGCATTGCTGGAGGGCACGGTGCTCAATTTCCACC
TGTGCGTTCCGCTACTAAAACTCATTTTGGGTACGCCGCTGTGCATGGACGACGTAAAGTACTTTGATCCAGAAGTCTACAAGAGCATGACATGGATACT
GGAGAACGACGGCGTGGAGGCGCTGGACCTGGACTTCAGCGTGATGGAGCGCGTGGGGGACCGCACCATGACGGTCGATATCATTCCCAATGGACGCAAT
GTGGAGGTGACCGACGCCAACAAACACGAGTATCTTGAGGACAAATTTGAGCACCTGCTACTTCGGAGTGTCGCTGACCAGCTCTACGTGTTCCTCAAAG
GCATCTACGAGGTCATCCCGCAGCAACTGCTAATGCTGTTCGATTACGAAGAGTTGGACTACCTCATGTGTGGGTCCCCGGAGATCGACGTGGACGACTG
GGAGCATAATACATCCGTGGCCGAGAGCGTAGCGCGTTCACCGACGCTTGGGTGGTTCTGGGAAATCGTGCGCGAGATGCCCAATGAGTATCGGCGGCGC
TTGCTGCAGTTCACCACTGGCTGTTCGCGTGTACCGCTCGTGGGCTTTAAAGGACTCACCAGCTACGACGGCAAGGTATGTCTCTTCACGATCCGTGGCA
TCGTAGGTGCTCCCGACGAGTTTGTGCGCAGCTACGCGTGCTTCAACCGTCTGGACCTGCCGCTGGGCATCTCGCGCTCGGAGCTCAAGCGCATGCTCTA
CGCCGTGCTGGACACGGAGCTATACGGGTTTACAACTGACTGACCGACGCAGCAAGGCGAGATACTGGAAAAGCGATCCAGACACGAATTGACCACAAGT
TGAAGTGTACCATTTGTTTTTATTTGCCGCATAATCAAGTTGCTTCATGATTTGAC