Description :
From Genome Similarity Track
Location :
Scaffold_51:245282- 249921
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15726hypothetical protein
Phypa_INRA-310PPTG_15727hypothetical protein
Phypa_INRA-310PPTG_15728hypothetical protein

Sequence
4639 bases(100 bases per row)
CTCATCGAGGAGAAGTGTGTGGCTTAGCGTGGTCTCCGGACGGTGAAATGTTGGCTTCGGGATGTACCAAGAATCAGTTGAGTATTTGGGACCACACTAT
GTTAAACTCAAGTGCGCGATCGATGCATAAGCATTGTGCTCCGGTACGAGCGTTGGCTTGGAGTCCGTGGCAACGTCTTGTCTTGGCTTCGGGTGGGGGA
ACAGCAGACGGCACGATCAAACTGTGGCGTACAACGACTGGGAAGTTAATGCGCTCTGTATCGACAGGGTCGCAGGTATGTGCGTTGGCTTGGTCCACTA
CAACTCGAGAGCTTTTGTCGGCGCATGGATACGGCTCAGATACACATGAAATCGCGCTGTGGAGATTTAAACAATTGGACAAAGTGCATGAACTCACGGG
TCATAATGCGAGAGTTTTAAACATTGCCATCTCGCCTGACGGATCGACTGTTGTATCTGCTGGAGCGGACGAAACTCTGCGGTTCTGGAACATGTTTCCA
TCGAAAGCATCGAATACTCGCTGGAATGGAGAGTTCTTGAACTCTTGTATTCGCTGAATAAAACATGTTTAAATAACATAAAAATCTCACGTACATATAT
TTCGTATCAGCCCGAAAAGTCTGTTGATTTTTTGCCCAAAGAGAAGGCACCTCATCAAGTTGTAGCTTGGCGCTGATAATGTACACACGTTGCTGGATTA
ATGCCGCAGTGTTTGGGCTTTTTGAACTGTTTTAAGTGCCTTGTACGTGGACTTCTCCGCCGTTCTGGGGTCCAATCGACGGGTTTTGTCGAATCTGGTA
GGGGGTTATGTCATTTTCTTGATCTGGTAACTTCTATTCAACGCGCTGCTCCGGGATCCGCTCAAAGCGCCGGTTATTGGAGGCGCCACAGCTCATATTC
TTGGGTGGGCCAATGTGGATGGAGCCTCGGTAGCTGCCCCCAGCGAATGTATTCTGAGGCATCCCCATCTGTGCCCGTTGTTCACGGGTACAGATGTAAT
GCCCAGCCAGTCCGTCGGCCGGGATCAAGTAACCCAGCGTAACCGTACGACGCGGTCCTTCGCGTACCGACGGGAGGCCTTCGACTGGCAATACCGGGTC
GATCTGGAAGCTCTCGTCGTTAGAAATGAGAACCAACTCGATGTTAAACATACTCGCAACAGCATACAATTCAGCTGTGGTGGCCTGTTCATCCGGAGTG
TCCCGGAACGTCTCGTATCGTTCCCGAACGTCTTCTTCGTCCTGCATTAAGAAGCCCGCCAGTTCTTTGACATGTTCCAGCGCGTATTCCATCAATTTAA
CCCTCAAAAACTGCGCTGCGGCCACTCGTCGAGGCGCCATGCCGTCTGCGGCGCCTACATTGACCACAGTCATACTGGCGGGATAGTCTCGAAGACACTG
CAATGGGTACATCTCGTACACGATGCAGTGTAGTAAACACGAGCCATCCGGAGGCATTCCGACGCCTACGAGGCCCGTTTGCACCAGTTGATCCTCCATT
TTGGCTCGCTGCATATCCAATTCAGGTGTGATGACATCAGGCGCCGTCATGGACATCATAGAACCTCTAGAGAGCGACGCCAGGGACGCACGACCTGTAG
AATCCGATACAGTGGACGAGGCCGGGAACCAGCTCCCTCGAGACGATCCTGGCCCAATGGAGCCTGCAAATGACCCGCGACTACTCGAAAAGGACGTGCG
ACCTACATTTTGAGGCGCTGTGTGTCTGGCGAAGCTCTGACTGCCTACAAAACCCGTCCCGGACCAGCGATAGTCGCTGGCATTGGACGCGAAGGAAGAG
ACCGTGGAACTGCTGGAAACGGAGCGGAAATCGTCGTCGTCGTCGCCCATAACACTGGCCGTGGCCTGTACCACTGCGGGGGACGCCAAAATGGACGAGG
AAGGGCGAAGACTCGAGTCCTGCTGGTCGTACTCGGCGTTGGCGCCGAATCCCGAGTTAAAACCCACGAAACTCTTGAGTGTTTGGCTGCTTACGGCAGC
CAAATGGAAGGCTACGAGCTGCGGCTTGTGTGTCACCACGTTCATGTAATTATCGAGTTCTCTGGCTCTGGCGCCGAGGAATTCCGGGCTTTTATCCACT
CGGAAGAGCGCTCGACGACGATATAAGGGCGGGAACTTGACGCCCTTCATGAGCGCGGCACTGCGCTTACGTAGCTGCTCGTCGAGCTTGCGGAAGGCCG
AGAAACTGCGCCAAATGTGCCAACTGGTGCGCCCTGTGGCGTGTGCGCGGGACGAGTAGAAGGACAGCTGGACGACCACTTTGTACTCGGCCTTCTTGCT
GCTCAGACGGTAGTCTTCCACGCTCACAGAGCACGTGTAGTCGCCCTGGATGTCGTCGGGCGTCATGGTCAAGTAGGCCATGAGGAGAGAGGAACGAGGG
GACGGGACGGAGACTGACGGACGTCCAGGGAGCTGGACGAACTCTCTCTGACTTGACGACGATCGCAAGACGCGCTTATCCGTTTCGACTCGATACAACG
ACTGGCAGGTTTTCAGCCTATCCCTGACCAGATACGAAGTTCCACCGTCCGGACGTACCACTTTGATGGATGTACCACGAAAAGGGTACGTGGAGAAGCG
GAATTTTCTCCAAATAGTTGAAGTTGGCAACCAATCGCCTGGCTAAAAAATAGTTTTGTTGCGAAAAGTTTTGAACTGGAATTAAGTCTGGATGTAGGTT
TCCAGTTAAAAATTGTGGTTGTTGCGAAAATTTTGAACTGGAATCAAGTCTGGATGCATGTTTCCAGCGGGCTCCGTTAACTTGTAAACGGCGAAGAAAT
GGATTTCTAAATCCAATGAAGTGCTATCCAGTACAACTTGATCGACGTTACGTCTTGAGCGGGGTGGCTTCAGGCCACTTGACGCTAACGAGACAAGTCT
TGTCGACCACATCGTACAAATAGCTACGTTTTGTCTTACAGGAGACGTCTCTATCTAGCATCGCAGCTGCGGGGTAGCGTCAGATGCAAGATTCTAGGTG
CACACCTCTTCACCACCGAATCGCAAATTTTGACATTCGAATGCGGTCTCGGCTCATCGTCCGAGATCTCGCTGCTAGAGGTTTATGAGGTGTTTGGCTG
TCGTCTAGCGAGCTGCGATACAAATCAACACTGGCATCTTGTGTGGAGTCAGCGATATCAGCGTCGCGATATCAGTGTGGCGAAATCAGCGTAGCGGCGA
CAAGAAACACTGTCAATTCGTTAGGTTGCACTTTATGTACACCACACAAACTGTATCATTCTGGTTTAACACTAGACCATTCACTCGTAATAATGGAGAC
CGAGGCCAAGGCGCTGCTTGAGGAGCTCCGGGCGGCGCAGGAAGAGCACGAGCGTGCTCTTGTAGCTGCAAACCAAGTGCGCAACAGGCTCGACCGTGCA
CGAAAGGAATATGAAGAAGCTCGAGCTGCAGAAAAGGCCAGCGAGGACGAATTGGCAAAGGCAGCAGAGGCTCTGGCGTGTGGTCTCCAGAATCTCGAAG
TGGACAGCGATACAGCAGAGCTGAATGCTACAGTGCCTCCGACAGTGGACTCTCTAGTGGAGTACCATGCAAACATCGGCTGTTACCAGTGCTATCTCTT
CTTAGACCGCCACATACAGAGCAACAAACAAGAGGGGACCTTCGATGTGGCAAAACTCCTCGTTCGTGTAGAATTTCCACGCGTAGAGCTTACATTCCAA
AGCCAGGGTGACAAGGAAGACGTATTAGTTATCTGGTGGACGGAAATTGAGCGGAATGTGGACGTCTCGCAGTGCGTATTGGAAGATAAGGACGATCACT
GGTATCTGCGACTCCCCATCCGTCCAAGTGACAAGCAACCGCTGGGAGGGTTCTCCTCATTCACCCAAGTATCTAACATTGAGTTGCAATCGGATAGCTA
CACGTCGGTGTGTTGTCGAAACTGCAACGCACAGTTACTTGGAACCACTAGGATCGAGAAGGTGCTACCGTTACCGTCTGCTAATTGGATGGATATGTTT
GACTTCTGGGGCGCTGGCATCGGAGCTTTCGAGCACATTCCTCGTGATGATATTCATGCTCAAAAGCACCGAGTGCTCGTCGGAGAGTCATACGTGCTGT
TACACGCTAGTGACTTTTTGACGGATGCAACGGTTGGAGTCTGTGAGGACGCTGCTGTTGAATCTAAAGAGGAGCGCGAGTGGATGCCGCTGACCTGTGC
TGCGTGTTCGGAACGTGTTGGTTTGTCCAATGTAGAGCAGCCAGATACAATTCGTCTTCACAAGCACTTGGTCATTGCTGGAAAGCACCTGAAATCCTCT
ATTGACGACGACAATGTGTTTGCCAAGTACACGATCGACAGTATCCTCAGTGCCAAATTGTTGGAAATGGCGGATGCAGATGGAAAATTTCGGTTCATTT
TGACGTCGAGTGATGATCATGATCACGAATTTCAGAAATGCAGTCATTCTCCTGCCACTGGAGATGGATCAGAGTTGCTACTGCAATTGCTTAGCTGGGA
GACGATGATCAAGCAACAGGATGCGACTAAATTCCGTCGCGTTCTGAAGGTTCTGTACGGTCCTCCTCAGTCGATGCCCGCGATTCCCGGACTCTTGCCT
TCACAGGAAGTGGCACTGCCTCCAGCCATGTACTCTGCC