Description :
From Genome Similarity Track
Location :
scaffold_335:24524- 30665
Transcript NameFunction/comments
g7395.t1 conserved hypothetical protein
g7396.t1 hypothetical protein PHYSODRAFT_312953
g7397.t1 conserved hypothetical protein
g7398.t1 hypothetical protein PHYSODRAFT_493396

Sequence
6141 bases(100 bases per row)
GCTTCTTGGTCTTGAGGAAGGATAAAATAGCCGGAATCCTCAATTGTTCGCGAAGAATCTTGGACGATAAGAGCGTCCTCCATCGAAGCACCAAGCGGCC
CAATCGCCGAATTCGCTTGCAATGGCTTCTTTGAGTCGTACGCTGCCTGATTCGCGTAAGCTGTGAGCTCGTACGAAGTAATTCCAGCAAGACAGCTATC
GTTGTACTGGTCCTTCACCGCACACCGCAAGGCAGCAACATCCTCCATATCCACAAAAACGACATCAGCCGAGGCAGCAGACTTGCCATCTCTATCCATA
AACATGAACCACTTCCGCGCCATGGTGCAAAACTAGAAGTGAGCGCGTGGGAATCACTTACTTGCTTGGCTGACAGAAGGTGACACTAATCCGAGTTTTG
TCATTCCATTTCTCATGGAAAAATGATTCAGAGATGGAGAGTGACCAGAACAGTTTTGGATAAATAGTAAGTGCAATTAGCTTGCAGTAGTGTCATCCAT
ACAGCGCGAACAATGGCGCAGCAGTGTTACTCTCCCACCGGAGCAGAGCCATCGCGATCTGGTACTTCCAGATCGTGGCGTGCTTCATGCTTCGGCCATT
TAGGAGATTACCACCGAATGTGACGTCACAGCCTCGCACAGGAGGCCTTTGAGGCCCGACAACTCCTTGTTCTGCCTCCTCCACAGGTGGGTCCGTGATC
ATAAGCCAGTAGAACATTTCCATCCACTGCACATTCGGGTCATCATCGTCCTCGACGCACACCGCGGGGTTGTGCGACCGGAAGCAGATGAGGTACCCGT
TCGGCAGTCGTATCCGGAACAGCAGGAAGACTGTGCGGAAGATCGGGGCTGAGCTCCCTTCCTGCAGGTCTCGGCGGATCAACAGCGTGTTGTCGTTAAT
TTTCTGTAAAATCTCGAGCTTCTGGACGGACGAATAGATGCCGTGGTACAGTCCAAAGTCGCAGTACATTTCCCAGCTCTTGTGTACCAGTTCCTCCGTC
CCGATGGTCTCAATTCGCTTCGTGAAGTTGAACTGCACTCGTCCGTCCTGTGTGATCCGTTGGTGCTGCGTCCAGCCCATGGTCTTCTCCTCCTCTCTAG
CCTCCACCTTCTGCATGGTCTCGAAGAATGACGTCGCTTGTCGGTGCGAGTCGATCATGATGTCTCTGGCTTCGGCCACTGAGAGCTCCTGGAAGTGAAT
CGTACCGATGGACGTCCTCGAGCCCAGTTGTCTCGGGATCTGGAAGTCGTCCTGAAGCCGCTGTAGCTGCTCTCCCAGTGCGTCGTAGATGAGAATCTGG
TCTTTGAGCTCCGAACTTTCTCTACGGAGTCCGCGCACCTCGTAGATCGAGTGCACGAACTTCTTGAACAGAATGTCGCACAGACTGCGCTCATCGAACT
GCATCCAGTCGTGCTGGCGTCTATAGGTTGTCAACATCTTGTTTAGCTCCGTCTCCAACTCGTCATTCACCTGGCGCAGTCCCTTGCGCTCGTTCTATTT
AACCCATCATATACAGTTTATAAGAATTAACTCATTACTAACAGCATAACATTTCAGGATAAGGTTTGCCGTCACCTTCTTGCGAACGCGCGACTGGCGC
ACGATCTCACAGTGCTTGAGCCGCTTGAGCTCAGCCTTCGCCATGCGGCACTTGGTGTCTGACGGTAGACCTGGCGAGAGCTGCATAATGCGGTGCTCTA
CATCATCCAGCGTTACTCGCTGCTTTGCAGGTTTCTGTCGGCGCCTCTGGACTAGATCAGGCGTAGTTTTACTAGTTGCCGAAGACGGAGATGATGGCGA
AGAACTCGCGGTGGTAGTGTGTGCTACAGGCGCGCGCAGTGGCGGCGGCGGCACGAGCGGTGGCAGGCGAATCGGCATTACTCAGGTTAACGACGGTATG
ACTTGGTCTTGTATGGCAAATATAATAGTGTGACGTTAGTCATTACGAACGCGTCAGTACAAATACTACTTGTACTGACACAAATTGATGTTGAAGCACT
ATTCAGCACTACAGTGCTGAAAGCATGCTCAAGAATCGTTTTACCAACTGTACCCTCACTGCAGTAGTGTACAGTAGTGCATTGCTGCGTTCTTGATCTC
ATGAATCAAAAGACCTCAAGGCTCTGACGTCGTTCAGCAGACTGGTACGCTGTACCATTTGGTTGTTGAAGAGGCACAACGCGGCGACTCGATGGACAGC
GCCATCTACGACAAGCAGTTGGCCTGGAAGCTGCACGGACAGCGCAAGCTGGCGAGTAAATCACAGGAGCTGCGGGCTCAGCAGGACAACGAGTGCACGT
TTTCGCCTAAGGTGGATACTTCAACCGATTTTTGTAGTGAAGTTACGGCTAAATTAATGTTGCAGACGAACTCGCGGTCGTTGCGCGCAGTGGAATACGC
TGCTGAAGAGGAAGAAACCCATGCAGATCGCTTGACTGTAGCTAATGCTGCTGAGGCGGAGGCAGCTCTACTGCACCCAACGGAGTCACAGGAAAGCTCC
ATCCAGATGCATCTGGCACGACAAGAACGCGCTCGGGAGCATGTACAAGAAGCGCAACACAAGTACGAGAGACTGCAACTCTGTAGTGGAGGCTTGGGTG
ACAATAGCTTTGATGGTATGCAACTTGTGGTACAGGTTGGCTGGGGTACAGCTGGCTAAGGACTACAACAAGGTCACGACAGTCGAGCCTTTTACACTCA
GTACGACGAATTGGGTGAGGCAAAGTGGCTGAACAGCCTGTAAACCTTTGCTGACCGTGGAAATATCTGCAGAAACCACGGCAAAGCACGATCGAGTCGC
CGACCCGACAGGTTCATGAAGTGCAGGAGCGGCAGGTTAAGTCAATGAAACCAGGAAAATCCAAGGCAAAGGGACAGACCCCAAGATCCAGCAAGTCTCC
TAGATGCACGCATGCATCCTGTGACGTTCCCACGACGTCAAAGGAAGAGGAGGCTTGGGAAAGGTACGCTGAACTCTTCTTGGTGTTTTTATTGAAGAAA
TTGACTGGTGACAACACAGTGAACGAGCGACGCTGGTCTCAATCATCGATGCGCAGCGTCGAGAACTTGCGCTTCGAGAGCAGGCACAGCAGGAGGCTGT
ACGGGTGGCCGAGCGGTTCGCAACTGCGACCCAAGCTTTCGAGGAGCGACTTGTAGCTGTGGAGCAGTCTGCGGCCAAGGAGCTGGAAGAGGTCAAGCGG
CTCCTTGCCAGTCAAGCTGCTGCTACGGACCTCATTCTCACGTCACTGGGCATCACACGACGGCCAGGATCCAGCAGTGGTAACTCGCGATACGACTGAG
CGATGCAGGGAGCTCAGATCGGGACCTTGTTTGCGAGATAATGGAATCAACCGAGCAATACGTCGGTACGTGAGCTGCAAGCTGGGTAGTCAATTGATTA
TATAGCACAATACACATCGAACCCAGCACAAACCTCGCGACGTTGAGTGCTTCCTTCTCCTGTACGTTGCGAGTCGATCTGGGCCAGGCTAAGTTAAATG
AGAAAACCCTGCTGCCTACCATGATGATGGCGGAAGGGTGAAGATTGGGCCGACCATCATGTTCTCCCACTTGAAAACGATAGACAGCGTGTTCATGGCG
AGCGTAGGGATCGACTCGTGATCGCCGTAGTCCATGCAACCGCCGTACTCGACCTGTGCGCCTTCCTGGTAGAAGGGGTCGCTGTTTTCTCCATCCACCG
TAGGCTCGAAGACGAACCAGCCTGACAACTCCGTCCACTGAACAGGTTTGCAATCGCGGCTGATGGAGCTCAACGTCGGATCCGTTACCCGCTCGGGCGA
CACTGACTGCACGCAAATGATGAAGCCCTTCCGAGTGCGCACACGGAACAATAAATACACGCATCGGTAGAGCTTGGTGCCATCTTCACTGTGAGACTCA
CGCAAAGCCACGATTGTGTCATCGTTCACGCGCTGCAAGATGCGGAGCGTCATGAGGCCCCGGAATTTGATCTCTGTGCAGTCCGGGTCCGAAAAGCACT
GCCATGTGCTCGTCATCAGCTGCATCGCATTCTGTCCGGGGAAACGCTTGCGCAGCGAGAACTTGAGGCTCGTTCCGTCCAGCAGCCTCTTGTCCTCCCA
GCCCATGACGTTGGCTCCCGAACTGATTGCTCTACCGCTGAGCGAGAAGGATAGAATGGAGCGGTAGATCTCGTTCACGAGCGCCGTCGACTCGCTGAAA
CTCAACGGTTTGTAGCCCAACTTCTTCTGCATAGCCACGGCCAGTGGCGTCTTTCCTGTGATAGTCGGGCCCACGAACGTGGGGCGCGGCTCGTTGTAAA
ACGGCGTCTTGGTCTTCTGCGTTGAGCTCAACGGCGAGATATCGCAATCACTACCATGTATCGCCAGAGGTGAGACGGCATCCAAGCCCATAGGAGACGC
CGACGGTGAGTTCGTGGGCAATGAAGCTGTGGACGACGTTGTAGCTGTGTCTGAGTCTGTATCTGAGTTGTCTGACTCGTCGGACGAGATGGAGGCCGCT
CGTTGGGCCAATGCCACCATGTTGGTGGCGAACTGCTGCCTGTAGTTGAGCAGCAGTCGTAGTCTGGCTGCTTCATTGCCCAGTTCATCCTGCTCGTTCG
TCAGCAGTGCATATCTTCTCTGAATCTCGTTTGTAGCTTTGGCTGGGGGCGGATTCTCCTGCGTTTGTTTGTTCATCGACAGCTTCTCCAACTGCTGCTC
AAGCTCCTTCACTGTATCCCTCAGAGTCTTGAGCGCCGCCTACAGTCAAAAGTGACAAAAGTTGATACTCATTAGCACCATCTTCCGTCCGTAACATTCT
ATAAGACTCCATCTTCTGACCTTATTGCGGTGGTAAGCGCGTTTCACCACCTCGCGGTGTCTGGCGCGTCTCTCAATGGCCGAGAGTTTCCCCTTGGGCG
AGTCCTTCCCTGCCTTCGTGTCCGTCGTCACGGGAGAGGCCGGCTGCACTTCCTGCAGTAGCTGTGGCGGTGAGGTAAAGGCCTCCGTCATGTCCACGTC
CTTGTCTCCCGCCTCAGGCTCTGTAAGCAGCAGAATGTCCAGCAGAGCCTGGTCATCGGCGCTCCAGTGAGTGGGTGGGGCCATGGAGGCCCCCGGAGCG
TGCATATTCGCGTGCTTGGGCGTCGCCACCTGCATCAAATGGGAGGCACAGAGCTTCTTGGCGTCTGACCTGCTGGACTGTCTCGCGGGAATAGCATTTT
TTATCCAATCACTGATTTTAGCGATAGAAACCTAAACTCGGTGCGCCTCGTCTCATTGCAAATTAAAAAAAATGATGATTAGTTGAAAATAAAATGTTGT
TTACAAACTTCAAGTCAAAATAGAAATGCCTCTATTACAAGGTCGCGCCCGTCTCATGGCGAATTGGAAAATAATTTGATTAGTTAAAGAAGAAGTTCAA
CATTTGACAAAATGCTGGACACCACCGCGCACATGCTGTTGCTGCTGCAGCAGGCCAAGATCAAGAACGAGCAGCCCGTGGACGCCTCCTTTCTGCCTCT
GTCTCTATCACTGGCATGTTTATTGCGTCAATTACCTGCGGGTCTGGCGCCTCCCGTCGGCGGCGTGTCATTTCTCCAATTGGATCGCCTGCCGCAGGAT
GCGCTAGAGCGTAAACTCGCCTCGATGCTTCTGGACGACCCACTGCGCGCCTTCAGCTTCGTGTGTGCTCTGGTTAAGTATACGAAGCTCACGCGCGAGC
TATTGGGCATCTGCCACGACCACATGAGCAACCGGAAGTCCACGGTGGAAGCAACGCAGAGTGTTGTTCAGGCTGTCGTCCAGGCGCTGCCGCCATTGGT
CCTTGACGTTGAAGAGGAAGAAGAAGAACAGCCTGATCAGGTAGAGATACAGGAGGAGCAGACGCCCGTCTTGAAGAAGGAGAGACCAGTGAAGGACGTG
AAGCCTATTGCACCGCCAATTAGGACCGACCAGGCCTCGACGGTTGTCGCGACGGATCCAGTGGCTATTATGCGTCGAGCGGTGGGTCGAGATGTGGGTG
ATGGGAGCGCAGTATTGCAGATTATGAAGAAATTCCCGATGGATGTTCGGATTCAATCGCACGGCGTTCGAGCTTTGAAGGGCGTGATTCGAAGTGTGGC
TGCTGTGGAGGGCAAGTCGACAGAAAAATCCCTCCCAACAG