Description :
From Genome Similarity Track
Location :
Scaffold_254:24522- 30225
Transcript NameFunction/comments
Phypl_g6019conserved hypothetical protein
Phypl_g6020hypothetical protein PHYSODRAFT_284561
Phypl_g6021hypothetical protein PHYSODRAFT_358780

Sequence
5703 bases(100 bases per row)
CAAATCGTCTACTCAATTAACCTGGTCCTTATGACAAGTCCCCAAAGAGATCCAGGTCTAAAGGTTCAGTCTTTTCCGTCATGAAGTCGGtgtcatcctc
gtcgtccgtgtccGAAGACGCATGGTGACGGGCCGCGGCCTTTTCAGCACGACGAGTTGGTGTGCGGATGCTGACACCGTTCGAGTTTTTGCCATTGCTG
CTCGCGACACTGCCAGTTCCCTTGTGCTCGCTCGTCCTAGAACGAGTGCGGATGACAAGCGCAGCTTCCTTGGGCTTCTGGTACTGGTACGTGTTATTGT
TACTGGACGACGAGTACTTTGCCCGCAGCGCCCGGGTCTTCTCttcgctcttcttcgctaGGAACTTCTGGATAAGCTGACGCTCGTGGTTGCTCATGTA
CGTCATTTGCGCGTTCGTGTCAATGACCAGGAAGAGTTCCTGGTATTCGGATTCCTGGTGTGCGAACGCAGAAGCGGGCGAAAACTCATAGGAGACCACT
TCAAGAATATCGATCGAGTCACGATGATACGGGATACGTGCAAAGGCCAAACGCTCCGTGGGAATGGACAATGCGGCGCTAACAGCATCCGCCAAATACG
TGTCGGGACGGTTTTCTTCCTCCGCAGTAGAAATCACCACCTCGTATCGCATGTTCTTGACAAAACGCCACGTTGCGCGGTTCACATACGCAAATTCAAC
AATTCTGTGGTTGACTTGTGCAGTCTCAGGCTCCGACAAGAGTTCTGCCACAATGCTTCTTCCTTCATACACTGCAAGTTTGGACGCTTCCACGAGCTTT
TGGccatccaccagcacgctTGTCATGGTACTTTGACGCAGGTCGCGCAGGCGGATATGAGATAGAGTCACCTTCCCGTCCTCGGGCTGCACCAagttct
tctccaccaactcATTCCACACCTTCTTACGGATATCCTCCACCAGCATTTCCTCGCTGATGACCACCTGGCTCACAAATATCAGCAACGCGTCGTCTTT
TCCTGTCGCCACTAGCACCTCATCAACGTCAAACAAATCCTGGCTGTCGCTGGAATTTGATTTCGTCTCGGTAGGCTGATCCTGGTTGCTGCTATTGTCG
CTCTCTGGAGAAGCCGAGCCAGCGTTGGTCGGGTTATAGAACATCAGTCTGAAGTTGTATTCGCCAGTGTTCAGCGGTGTGCCCTCCAGAGCGAAGACCG
TGTGGTTGGAGCCAATCGACAATTTCGACAGAGTGCTATCAATCGCCTTGATTTCAACGCCGGCACTGTTAATGCCACGCAAAAGCTTGAATTTGTTCGA
GGGGAGACCGATCTTGGCACTAACCCGCTCCTTCAGGATGCGAATAGTCTCTCTTCGGTCGATGCGAATAGGCTCCGCCGGACTAGTCAAATACTTGAAA
TTGACCGTGATCATATTGGCCTCACGCTCAAAGTACGCCTCGGCCGGTGAAGGGCGTGAGAGATCGGGTGTTTCCTCGAAATACAGCTCTGTTCCATTCA
TCAAGTGTAAATCCATCTTCAGGCGCAAGTTCAGTGtgcgctcttcgtcgtttGCATTTAGAATTTTGGCTGCGGAAATGCTGTATGTGGTTGCACTCTT
CTTGATCAAGCGAATACTTTGGTCAGCGGGGATTGAGAATTTCTTTGCAATGAGAGCGCAGAGCGATCCGACAttcgcgtcctcgtccacctgaACGCAC
CTCGCCATGAATACATCGTGGGGTGTCTTACTGCTCTTGTTAGCATCATCAGAGTCCGCGTCGACAAAGCGGCGGACAaagagctggagctttgTCGGGT
CATGCTCCTCCCActcttcatcgtcgttcTTCACCTCAAGGAACATCTGCTGGCCAGCGTAAATTCCTAGCGATGACAGGCTCATGCCCTCCTTGTCGTT
GTACGTGTCAGATAACAGGCAGTTATAGTCGTTGTACCCGCGCAACCGCACATTCTCGAAGGATGGGACTACAACATCCTTTTCCTTGGCGAACTCCTTG
CACGCCAtctcgagcgcttcgtgGATGGTCGCGGTCTTGTATACATGGATGGTCTTCTCTAAATTTTTGGGCCTGGAACCCTTCATGAAGAACTTCACCT
GCACCTTTTTGGCCATCTCGATCCGTTCCTGCTCAAGCCGGTGGATTTTTTCCTCATCGGCGTGGATCCTGTCTTTCAAATACTGCGGGATGCTCTCAGG
CAAGATCACATTAACATTCTTGTCGGCATTCACCAGACGATACAGGAGCATGTACGCGCAAGTGCTGTAACGCATGCTGTATCCAGAGCCACTTGCACCC
CCGAATGCGGTCTTGAGTTCCGTGTCAGAAATCTCGCTTACGTTGGagtcgttgaagttgtaCCATTTACCAGTCTCTAGAGATTTAATGTACGCGTAGT
AATGTCCACCCAGCGCACTGCCAGAGTGAATAAGAACCGAGTACAGCTCATACACATGAGGCCCTGAGCGCTTGATCATGGCCTCTGGGTCAAAAGTCGG
GCTCCACGTGTCAAATGAAGTGGCCCCGTCCACATCgtcatcctcttcatcctcgtccttTTCGTCATCTTTGTCAAACGTCACCGGTTGTGACTCATCC
ATGGACGACAGGCGGCGCATCCGCTCGCCCATGGCGGCAAGTACAGGTgttggaggaggagaagaaggtgttGCAGGCACCGTATCTTCTTGTGCTTTGT
GGTGGTTCTTCCCCTCCAGCACATGGCGCTCCATCGACATTTTCCTGGCAATCTTACCACGAACGCCACCATTCTCGTCACTCACGTACGAGTTCATATC
CAGGTACTTGGGGAACGTCACCTTGTTGTGCAGCTTAATGCGGTTCATCGAGGCGTAGTCAAAGTCaaagcgcttgagctgcagcatcaaaaTGTACGGC
AGCTTGGAGAACTTGAGTCCCTTGATCGCGTCGCGTTTCACCTTGCACCTGTCACACATCCACTGGTTCTCCTTGTTCAGCACCTCCGGCCTCAGGAACA
GCTCAatggcctcctccaccgtcttcatcatctccgTCGACCCAAACGGCCGAATCACCAGCGACAGGTCCAGAAACGTGTCGATCCTCGAGCTCTCGTA
CCCACACTCGCAGCACTGCACGTAGTCCTTCAGCGACCCCTGGTACAGGTCGTTcaccagcgtctcgttcacGGTCCCTTTGAAAGACCTctccagcgca
tccagcagcacccggcagagctcctgcacgtcgtgctgctggaacacGTCCGCCCCCGTCCAGCCGAAGCTCTTGGTCAGAGCCTTCGTCGAGATCGAGT
CCTGCgtcgtcagctgcagcttggcaaagaggttctgcagctgcagtgggATGTTGTCCTCGTCtgcctcttcttcttcttcttcttggtcttcttcttc
ttcctcctccagctccgccgccttcttggccgcaTGGTGGCACGCCCAGTGGTACAGTCCCTGGCGGAACTCGGGCGTCATGAACATGCTCTGCAGCAGG
CTGTTCATGTAGCACGTGGCCCCTTGGTTGGACAGGCCCGTGAAGGCCTTGGCGGGCCGGCTGTAGCCGCCTgagctgctgtagctgctgccgccgttgc
tCGTGTAGCCCGGCGAGTCGTAGAGGCCCTCGAGGCCCGAGGAACTGTACCTGGTCAGCGCGGTGGACTGCACGCTGGGGCTCGAGGCCGTGAGCCCCTG
GCTGGCGTCCTcgtgctgcggcagctgcgtcagcacgGACGCCACCTGcgcgcggtgctgctcgcgagACACggagaactcgtcgtcgtcgctcgagtcc
CAGCCCGTGGCCGCGGGCTTCGGCGGGTCTGCAGGGCGCATGGCAGTGGCGGTGGCGGACTTTAGCTACTGGGAGATCCAATATGGGGAGGATTGGTGGT
GTACAGGTACATGACATTAGAGTACAGTGGGCGAGCGGCTAGAAGCGACAGAGTCGTACAGTATTATTTTAACGAATGCAAGCGTGAGCTCAAGAGCGGG
CAACGTGGGGCTATGCAAACACTTGTGGCCTTAGATATCATCGCTGGTCCGGCGTCCGGGACTCTACACCATCCGCGGCGTGGGGGACCTGTTCttcgcc
agcggcagctcctcgtccgagtcttcGGAGCCGTAGTAGGCTCGGTCGCGCTTGAGCGTGAAGGTGTCCGAGAGGAAGCCCAGCTCGCctgcgcgcagct
tctcttTCCGCCACATCGTGTAGCACACGCCCATCGCGACGGCGTACAGCACGGCTGATTGCATAAATAAAATAAAATCATCCAGCGCAGCATCCACAAC
CAAGCCATAAAATAAAAACAGTTATTAGCATTCCCACACCTGTCGAATGGCCCAATCAAAGGCAGCATTTTTAGTTCAATAGGGCGCACGCACCGGCTTC
AAAGCACGAGTTGGCGCCGGAGCTGGGCGTCTTGGCGTTGTGAATGTACAtgggctgcagcttcagcaacgagCCCACCACCAACTGCCACAGTGCACGT
AAAACAAacaatagcagcagcagcgttaATACGGGGGGCAACCTCGCGCTGTGCGACCACCGAAAGCGTCATGTCAGCGCAccaggaagacgaagccgac
gaagctgaagatggtACCGCACAAATAACCTGTAGGGGAGGGCAAAACGAGCATCAACAGAGAGAGGAGACGCGGGTGAGTCAGCCGGGTAGCGAGAACA
AGCCGAAAGAGCCGCCACGTACGCCCTCCACTCATGCTGCCGTCTGGTGCCGGTGGACTTCTCCTTCCTCGCGTGAATGAATTCAGCCAGATGCTAACAT
AGCTCCGTCCCAAGGAATATTGGCCAATCGGAAACGTTATCAGTAGATATGCGTACGTGATGTGGTACACACAATGTCGAAGTGCGCCACATCTTAGTTG
AAGTTTACGTCAACTATATCTATGCAGTGCCCCACCTCAGTCTCGATTTTCCCGGCTTGCTATGGGCGTCGCTaggaagctgcgcgtgctgtgcATGCAC
GGGTACCGCACCAATGCCAAGGTCATGGAGGACCAGACGCGCGGgctgcgcaaggcgctggcgccgcaCGCCGAGTTCGTGTTCTTGAACGGCCCCATCG
AGGCCCGCGGGCCTTCGGACGACGTCATCGAGAAGCTCTACGCCGAGCACAAGCCGTTCTACGAGTGGGGGAGCTTCATCGAGCGCGATCGGCCGCACCG
ACTGGACCCGGAGTTACAGGAGGTCAAGTATCTGGACAGCGGGTGGTACCACGACTACGTGGACTGGGACAGCACGGTCAAGTACATGGACGACCAGCTC
CCCAAGCTAGGACccatcgacgccgtcgtggggTTCTCCCAAGGCGCACAGACGATGACAGCGCTGACGATGTGGTACCtacaccaccaccacaagcgct
ggtggaagtgctgTGTGAGTGTCTGCGGTCCGCGCGTGCGTGGGGCTGCGCTGCGTCCGCTGTTCGAGACCCCCGATGGGACGAAGCGGTTGGTGCCGAT
GCCGTCGGTCCACATCGTTGGGAAGACGGACAAGTGGCGCAGCGGATGCTACGAGATGGTGGACATGTACGAGGATCGCCCCGAGGGAGCAACGCGCGAC
AAGTACGTCTTCGAGCACGACACCGGCCACCGCTTCCCAACTGGTGAgcgacacgagcagcttTACGAAGATGTGGCGCGGATCATTCGCTTGCACTGCG
AGT