Description :
From Genome Similarity Track
Location :
contig_103:24520- 26993
Transcript NameFunction/comments
g13514.t1XP_009536038.1 hypothetical protein PHYSODRAFT_339765 [Phytophthora sojae

Sequence
2473 bases(100 bases per row)
TGACAATCTGAGTTCGACGATGTTGCTATCCCTATTGTGTCGGCTGATGGAGCTAGCGTGCTTTATGACGGCTACGCAACTTTCCAGGACGACAGCGCCT
ACGTGAACGAACTGGGCGATAAGAACAATACGCGATGCATCCTGTCCAGTATGCTACCGCCCAACTCTATTCTGACTGCTTTGAACGACGCATTCCAAGC
GCGTCGATCGCTAAAGGGGCCATTGAGTGTTCGAGTGGCAATCTGTTCAAGACGACTTTCGCTGGCATTCACTTCGCCATTTGCGCGTCAGGCAAGTCTG
CTTTCACGGCGTACAGTAGTTATATGACCATCAGCGTGGAATACCTGGAGAACCCAGCTAACATTCCAAGACAACGCTACCGTGTGATGTTGTGGCGAAG
GAGTCGTAACTGGCGCCGATTGTTCTCTTCCTCCTTAAATTTCGACCAGCAATACGCGAACTCTGAAGGTTGCAGAGCACTTGGTGATGGATTCGTCGTT
GTGCACGTGCGTTATCTTCCATAGCATTGGCAACTCCAACGAGATCGAGAAGCTGCAGAACACGCCGAAAAAGGCAAATGGACGAATTGGAAACAGGAAC
AACCACGCTCCTTGTTGCACAGAGGTCAAATATGCTATCTTGGACACCATGGACTTCAACTGGACAACGATTGCCTCTAGCAAAAGTTCTGCGCTTGTGC
TTTCCTGTTGAGCGACGCAAGCGACGTCGGATCGAGAACACTGATGTTGTAATGCACTCGATGGGTGGGAGTGTCACGTCAATGGCATCGGTTACTGGAA
ATGTAGCTTTGGTGAGGGCGCGTCCTGGGTGGCCTTGAGCTCGCCGATGAAGGGGAGTATGGGGTTGGACCACTTCCAGGACTTCTGCAGCGATGTGTAC
AACAGTTTGTGTGGCTTCGACGTTGGGATAACGGCTTTATTTCTTTAGTGCGCGATAATCATGTGAGGCAATTGAAATGCAAGAGCGTTTCTTTCTTATT
GTGTCCAGCGGTGACTTGGAAAGAGACGAGAACTGACCGCGGAAGAAGGCTTTCGTCAAGGATCAGGAATGAAAGCGGAGAGATATTAAGTTAAGGACGA
CTGGGACAAAGCATACATTTCTACTACTTGCGACGCGTTTGCTTGATGAAGTGCAAGACCACGTCGCAGTATTTGGCTTTGAGTGGGTCGGTGGCGTCCA
GAGGCGCTACGGACTACTGCAGACGCTTCAGACAGAGCTGCTCGTTCTCCGTCAGCGGGTGGTTAAGTCCGAGGGCGTCTTGAGACTCGAGGGGCTGTCC
TTGAGGCCGCCGATGGGGAAGCCCTCACTCGACATTGGCATAGCGCTCCTTCTATTTGAGTTTTAATTTACTGTGGCTGTAGTGAGACGTGACTGGGTGT
CATTCGTCTTGGGGTATTGCTGGTTTTGTGCCTGCGGCGATGAAGCTGCTATACTGTTTCTGACATGGTTGCTGGGGATTGTCGCCCCGCCTGTGCTCTG
GGTGTTGTAGATGGTCGTTGTACTTGTTTATGCCATGAGTTGTGCTGCTTGCGTCTCCCTCTCTGTTGTGATTTTCCCCTCGAAGATGGCGTCATTGCGA
AGTCTCCACAGTAAAACTGGAGTGACTGTCGCCCAAATTCTCCATTGGAGCCTCATTGCTCCCGTGTGGTGAGGAGTCCATCGTCTCATACCTTATTGTT
TTTTTTCTTCTAAGAAAGCTGTCTGAATCTGCCTGCTGTTCGTAGTTCGTCTTTCTGGTCCGAAGTAGTTTGTTTCGGTAGTGGAGATTTGGAGCAAGCG
GTAAAGATCGCCTGATTTAAAGTTTGGCCGTGCGATGGGTGCATTGCGGTACGTGCGGGGCCAAAATGGAGTTGGTGGAAGTGCAACACAAGATGGTGGT
AAGGTGGTCCTCTATTTGATGTTTATATGTGTGTGTGTTTTCCCCTATAGAAGCCTTATAATATGCAAGACGTGACTTGATGTCATTCGTCTGGCGTGGA
GGAGATTGTCGTTGGCCATGGGGAGTGAATCAGCATAGGTAGGTATGAGTGGGTCTTGCACAGCTTGTAGTGGGTTCGTAAAATGAATGTTCTTGTCTGT
TTGGTGTTCACGAGTATGCGGGCTGCTTCAAGACTTGCTTTCGCTGGGGTGCTCCATTTAACTGTGAACAAGCGTTGTAGCGTTTGATCCAGTTCGTGAG
CGTGGATGTCTCCAGTTGTGGATTTTGTTGCTGTTTTGATCGCTTTCTGCGCTGTTTTATCTACGCTCGCAAGGCGTAGATATGTGTTTGCTGCGTCGTC
GTGCTGTTCTGCTGCTTGTAAACCGATTGGAAGTGCAAGACGAGAGGCAATGAGTTTGACGATTGAGTATTCACCGCGCGGATCATTTGAGTCCGGATCG
ATTTCCAACGCGCACCCAAGGCTCGTCTGTATTGTATTCCCGTCCACTTGCCCTTCAACAAGATCCTTGAAAT