Description :
From Genome Similarity Track
Location :
scaffold_1302:2452- 4201
Transcript NameFunction/comments
Pl_100890HECT E3 ubiquitin ligase, putative
Pl_100891hypothetical protein PHYSODRAFT_363530

Sequence
1749 bases(100 bases per row)
TCTATGGAGCACCTAGGATGTATAGATGAACAGTACGTTCGCTCGGCCATGCGCATCAATTTCCTTGAGGAAAGCGGCGTAGATGCAGGTGGATTACATC
GCGAGTGGTTCATGATGCTCACGGAGCTACTGACGGATCCGAAAGCGGGGTTATTCAAAACCACGCATGGAGAGGACCGTGCGTTCTTCCTGAACTCAAA
TTCCCGCTACGAAAATGGTGAGGAGCACCTTATTTACTTTTATGGAGCAGGACGGCTACTGGGGCGGGCATTGCTGGAGGGCACGGTGCTCAATTTCCAC
CTGTGCGTTCCGCTACTAAAACTCATTTTGGGTACGCCGCTGTGCATGGACGACGTAAAGTACTTTGATCCAGAAGTCTACAAGAGCATGACATGGATAC
TGGAGAACGACGGCGTGGAGGCGCTGGACCTGGACTTCAGCGTGATGGAGCGCGTGGGGGACCGCACCATGACGGTCGATATCATTCCCAATGGACGCAA
TGTGGAGGTGACCGACGCCAACAAACACGAGTATCTTGAGGACAAATTTGAGCACCTGCTACTTCGGAGTGTCGCTGACCAGCTCTACGTGTTCCTCAAA
GGCATCTACGAGGTCATCCCGCAGCAACTGCTAATGCTGTTCGATTACGAAGAGTTGGACTACCTCATGTGTGGGTCCCCGGAGATCGACGTGGACGACT
GGGAGCATAATACATCCGTGGCCGAGAGCGTAGCGCGTTCACCGACGCTTGGGTGGTTCTGGGAAATCGTGCGCGAGATGCCCAATGAGTATCGGCGGCG
CTTGCTGCAGTTCACCACTGGCTGTTCGCGTGTACCGCTCGTGGGCTTTAAAGGACTCACCAGCTACGACGGCAAGGTATGTCTCTTCACGATCCGTGGC
ATCGTAGGTGCTCCCGACGAGTTTGTGCGCAGCTACGCGTGCTTCAACCGTCTGGACCTGCCGCTGGGCATCTCGCGCTCGGAGCTCAAGCGCATGCTCT
ACGCCGTGCTGGACACGGAGCTATACGGGTTTACAACTGACTGACCGACGCAGCAAGGCGAGATACTGGAAAAGCGATCCAGACACGAATTGACCACAAG
TTGAAGTGTACCATTTGTTTTTATTTGCCGCATAATCAAGTTGCTTCATGATTTGACTTGCTTTTTGTATGCCTCAGCAATCATTCCGTTGCGCACTCCT
AGTAATCAAACCGTTACTGGCGTGGGCCTCACTCAGGATTTGCGTCCTGCAGAAGCGATTCCGCATCGTCGTGCTCTCCTTGTAATGGCGACGCTGGTGG
GCAAAGGCTTCTCTCTGCTGACCGCGACCGACCTCTCCGTGTGCTGCGCCGTTCTGGCCCTCGCCGCCGTCCTCCTCCTCAAACGCGCCGTACGCAAAAC
CGTCGACACGCCGCACAACAACATGATCCTCTCGGCGTACGTAGCAACGACAGCAATCGTCTGTACCACACAGCACAAACTAATTGTAGCCCACTCTGAC
ACTGCAACAGCGAGCAATTAGCAGACCATCGCATGCTAGCTGCCCAACGGTGCGTTCGTTGCAGTCCACAAGCAAAGAATCGAGCAGCTAATTAATATCA
TTTCATATGGCTGTATTATTTAAACGACAGGGAAGCAGAGCGAGGGTTTGCGGTTTGCCTATCCTGCGGCTTCAAGAACTTTGCGCGTGTGATGCACTGC
GCTCTCTGTGGACTACCGAGCACGGAATCGGAGCTTCCGGTTGTTCTTC