Description :
From Genome Similarity Track
Location :
Scaffold_171:24518- 26557
Transcript NameFunction/comments
Aphas_H257_18607TPA: putative rnase H family protein

Sequence
2039 bases(100 bases per row)
GCAATGCCCGACTGGCCAGATGATCCGCCGAGCCATTCCAAACCCGTAACACATGATGGAGCTCGGAGTCTTCAAGGCGTTTGATCCACCCTTGGGCTTC
GCGACACAACTCTTGAAGGTGTGGTTGTTTACATTGCATCCAACGGTTCACTTGGTGGACCACGATTTTGGAATCGCCGAAGATGCGAAGTCGGGTTAGC
TTTAAGCGGGAGGCTGTCATGAGAACTTCCAGTAGACCTTGGTACTCGGCAGTGTTGACTGTGGCATCCGTAACAACTCCTTGGGCGGCCCAGACCAGAT
CCCAGTTGGGTAACTTCCAAATACTTGCTCCATAGCTGCCGACTCGTTCAATCCGTTTGATGGCTCCGTCAAAAGTGGCCACGTAGAGTTCGTCCTTTTG
GCCCCAAACATTGGAAGTGGGGTGACGCAAGCCTCCACCACATCCCTCGCGCGATTTGGCATGAAGGGGTCCAGCGACAGTCCCATGTTCGCCAGCTCTC
CCAGGGGCGGTTGGGACAGTGATGGCCACGGGTTTGAGCTGGGGCGGACACTTCGCTCGACATGCTCTCTGTCAAGAGAGCAGGCATGTGCCAATGGCCA
TCTGCAGACTTGATTTGTACGAACGTGATGCTCCAAGGTGCCAATTGAACCGCCCAATGAAGGTATTCAGTTCGATTTTGTTTGTCCGTGAAGATCCATT
TCGCCGCAGAGTACTGGGTGTACACTATGAGTGGTTTGCCCGCGAGCTCGTAGTAGCAGACTTTGAGGGCTCGGAGCAATGCAACGATTTCTTTCGCCCA
CTTCGCCATTCGTGGTTCACCACCCTTGAAAATTCTTCCGCAAAACTGACTGGGTGCAGAATACCGCCATGTTCTTGGCACAGCGTTGTCGAAATTGCCC
AGTCCGTGACGTACAGCAGGAGGCGGAAGGCCTTGGACGGGTCAGCGTGTCGTAGGATTGGCATGGATGAGTATACATGCTTCAGCCCCTCAAAGGCAAT
TTCGCAGTCTCCGACACTTGCCCGGCAGCACCGGACTTTTAATCCGATGGTCTTGGGTTCGAATCCCAACACCGAATTCTTCGTCGGAGATTTCGTACAA
ACACGCCGCCTTGATCGAGTAGTTTTCGATAAATCGAGAGTAGAAATTCAACAAACCCGTGAACGATTGCATATCACGCAATATTTTGGGGAAGGGCATG
TCCAAGACTTGTTGTAGTCCACGTGGTTTTGCTGAAACCCCTCGACTGGATATGATGTGACCTAGGAACTCAGTAAAGCTCTTCCCGAACGTGCTCTTCT
TGGCGCTAAGGCTGATGTTAAGTAGGTTAGGTGCGTGAGGATGCGGTTAGTGAGTTCCACAATGCAATCCCAAGTTAGTGCACCATCCCCGATGTCGTCA
GCAAAAGAGGTTCGGTTGGCGATGGGCAGGTTGGCTTTGTCTTCGTAGGTATGATTCAATTTGAACATGCCCCGCGGCTCTCCATCTTCATTAAAATCAC
TCAGACCAGGCGGCATGTCCACGAATCCATTCAGGGCGTTCGTGATCATCCTCGGGAAAATCATCGGGGCGTTCTTGAGACCTTGGGCCATTCTTGTCCA
TTGAAAATGTCCTAGAGGGCAGATGAACGCACTGACTAGTCGGGCACGTAAGCTGGCCAACACCACCCAAAATCCACTGGCATTGTCCAAGGAGAGGAAC
CACTGTAGCCCATCGAAACCCGCCAACATCGAATCCAAGGTGGGCATTGGGGACAGCATCAACTCCGTCAAATCATTGATGGCACGATAGTCAATACACA
GTCGAATGTCGTTGCCACCCTTCTTAGGTACAATCACAATCGGGGAGGCCCAGGGCGAATTTGAGAACTCGATCAACCCATGTTTCATCAGGCCCTTCAG
GAGGTCGAATAATTTGGGCATGTACTCTGGTCGGACCCGGCGCGCACGCCCCGCAATAGGTTTCGCATTCCCGACATCGATGTCACACACAGTGCCACGG
GCGGCGGGGGGGAGACCATTTCCTGAGCTGATGAAGAAG